Which of the following single-stranded DNA molecules are likely to pair with each other to form double-stranded molecules? You need to select two of the following. All are written in the5'-3' direction. (a) GCTTAGCC (b) TAGTGAAT (c) ATGACCGGC (d) ATTCACTA (e) GCACGTAGG

Which of the following single-stranded DNA molecules are likely to pair with each other to form double-stranded molecules? You need to select two of the following. All are written in the5'-3' direction. (a) GCTTAGCC (b) TAGTGAAT (c) ATGACCGGC (d) ATTCACTA (e) GCACGTAGG

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 4TYU: The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds...

See similar textbooks

Related questions

Q: which two amino acid have two chiral center？ I know Isoleucine contain two chiral center，how about…

A: Proteins are composed of amino acids. They are linked together by peptide linkages. Proteins have…

Q: QUESTION 6 Calculate the Rf-value of SAMPLE B in the TLC below: 5 3 2 - 0 solvent front sample B…

A: The mixture or dissolved solute in a solvent is spotted onto the TLC plate. The solvent has traveled…

Q: The enzyme involved in the formation of fructose-6-phosphate is a/an A. isomerase B. aldolase C.…

A: Fructose-6-phosphate is an intermediate of glycolysis. Isomerases are the enzymes that catalyze…

Q: Explain why these two DNA samples give different results, when they're both 50% G-C. Fraction of DNA…

A: We know that E. coli is a prokaryote and Potoroo is an eukaryotic animal. The stability of DNA is…

Q: Draw and name an aldose and ketose having five (5) carbon atoms. Identify in your drawing the point…

A: Carbohydrates are a class of macromolecules that plays an important role as energy source for the…

Q: Starting from glutamine ,glycine, aspartate, N-10 formal-ThF ,how many ATP equivalents are required…

A: Glutamine : It is the most abundant amino acid in the body.It is synthesized in the muscles and the…

Q: how would I sequence this trypsin digest. Please explain step by step

A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…

Q: 14.0 12.0 10.0 8.0 pH 6.0 4.0 2.0 0.0 0.5 1.0 1.5 2.0 2.5 14.0 12.0 10.0 8.0 6.0 4.0 2.0 3.0

A: Isoelectric point is the pH at which the amino acid carries no net charge. It is given by the…

Q: What are the three names for the metabolic cycle that occurs in the matrix of the mitochondria?…

A: In the eukaryotic cells, the citric acid cycle occurs in the matrix of the mitochondria. The proton…

Q: What is the major difference between motifs and domains? a) Motifs are unstable on their own, while…

A: Motifs and domains are the structural elements of proteins that differ in their organisation and…

Q: What is thiamine? How much thiamine do humans need and where can they obtain it? What are some…

Q: The phosphate groups in the sugar-phosphate backbone of each strand of a DNA molecule have a pKa of…

A: A DNA molecule is a strand of polynucleotides, where each nucleotide consists of a phosphate group,…

Q: 1. What reagent will not denature protein? A. Sulphosalicylic acid B. Copper (II) sulfate C. Nitric…

A: - Protein denaturation involves the disruption and potential destruction of both secondary and…

Q: Using drawn graphs or image, xan you explain the factors like pH, temperature, substrate…

A: Enzymes - Enzymes are giant protein molecules that act as biological catalysts. Like other chemical…

Q: Use the diagram which represents a spontaneous reaction to answer the questions. Is the reaction…

A: A spontaneous reaction is the reaction that is capable of directing the reaction in forward…

Q: Fill in the blanks In the peptide, merrychristmas, there are a total of _____ peptide bonds and…

A: Peptide bond is the covalent bond which is formed from the condensation of two amino acids (carboxyl…

Q: A protein has the amino acid sequence DSRLSKTMYSIEAPAKLDWEQNMAL How many peptide fragments would…

A: Given to us is a protein with the following sequence: DSRLSKTMYSIEAPAKLDWEQNMAL and three reagents…

Q: 2. Vasopressin, a substance produced by the human body that regulates blood volume and pressure, is…

A: Nano peptide is a peptide molecule with nine aminoacids. There are specific tests for the…

Q: 1) All Lamino acids have an S absolute configuration except L-cysteine, which has the R…

A: Cysteine contains a Sulfhydryl group in its side chain that is attached to the asymmetric carbon or…

Q: Which of the following is not found within the cytoplasm of a cell? a) Plasma membrane b) Cytosol…

Q: Gases such as N2 and O2 can diffuse simply across membranes but not small organic compounds as…

A: Diffusion: It is the process of movement of molecules from high concentration to low concentrations…

Q: CASE STUDY 9.5, PART 2 Recall Myra. Her mother was contacted by the EMTS, and she mentioned that her…

A: Diabetes mellitus is a clinical condition characterized by hyperglycemia and high blood sugar…

Q: Energy Conversion by PSI and PSII Q2.1-Explain why 8 photons need to be absorbed just to move 4…

A: Photosynthesis is a process by which plant cells and other organisms make their own food by using…

Q: Which of the following fatty acids will produce propionyl-CoA in its/their last β-oxidation cycle?

A: Fatty acids metabolism involves β-oxidation which happens in the mitochondrial matrix. In…

Q: Fetal hemoglobin binds 2,3 BPG with greater affinity than adult hemoglobin. True False

A: Growing fetuses' receive oxygen and other nutrients from their moms. Fetal hemoglobin is the…

Q: Why cannot amylopectin be fully degraded by amylose alone?

A: Carbohydrates are polyhydroxy aldehydes or ketones. Depending on their size, they can be…

Q: Consider the following: NO3 → NH4* The balanced half-reaction is A. B. C. D. NO₂¯ +10H* +9e¯ → NH4*…

A: Oxidation is a process by which an atom loses electrons while reduction is a process of gain of…

Q: A fully folded, functional single polypeptide is in ____________________ structure.

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Which of the following statements regarding hydrogen bonding in secondary structures is true?…

A: A weak chemical link that exists between a hydrogen atom that is partly positively charged and an…

Q: Enzyme Triacylglycerol Lipase Rennin Catalase Hexokinase Enzyme Official Name (write N/A if…

A: Enzymes are usually comprise of proteins which work as a catalyst and increase the rate of reaction…

Q: 2. Classification of amino acids: a) by the structure of carbon chain; b) by the position of amino…

A: Amino acids are the biomolecules which are essential in the functioning of our body and plays major…

Q: What is the importance of biochemistry signaling to our health and development? How does it affect…

A: Biochemistry is the branch of science that is concerned with the chemical substances found in living…

Q: Why do we use methanol into the solid phase extraction cartridge to extract the acidic fractions and…

A: The acidic fractions in drugs contains groups such as -COOH. The basic fractions in drugs contains…

Q: Which of the following reactions in glycolysis is/are reversible? A. PEP → pyruvate B. DHAP → G3P…

A: Glycolysis is process of breakdown of one glucose glucose into two molecules of pyruvate with net…

Q: Which of the following pair of substances are products of the citric acid cycle? a) Acetyl CoA and…

A: Introduction: The citric acid cycle also known as Kreb's cycle is the final common oxidative…

Q: Using a biochemical map and text describe the process by which lactate is recycled from the muscle…

A: A soccer match involves rigorous exercise, The intense exercise requires a high amount of energy.…

Q: How do you explain Mr Willis’ dark urine and dark stools? Would Mr Willis benefit from any…

A: G6PD(glucose-6-phosphate dehydrogenase) is an enzyme which helps in proper functioning of RBCs. Its…

Q: Anaerobic pathways after glycolysis In the absence of oxygen, what anaerobic pathways can occur…

A: Introduction Glycolysis is a metabolic pathway where one glucose breaks and forms 2 molecules of…

Q: 5. Specific properties of amino acids in the organism: a) deamination; b) transamination; c)…

A: Amino acids are the building blocks of proteins, its alpha carbon contains carboxyl group, amine…

Q: How could nucleic acids have appeared without the enzymes that catalyze their synthesis?

A: Apart from the biological synthesis of the nucleic acids using a set of enzymes, the nucleic acid…

Q: Intermediary metabolism includes all the reactions in an organism involved in generating and storing…

A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…

Q: Cyanide binds to and blocks the action of cytochrome oxidase which is the last cytochrome in the…

A: Cyanide is toxic substance which blocks the action of cytochrome oxidase in the electron transfer…

Q: 4. What reaction is used to distinguish the protein from polypeptide? A. Biuret test B. Sorensen…

A: Polypeptides and proteins are organic molecules that occur naturally and are required by cells. They…

Q: please check if my answers are correct. Especially for prolin and Leucine

A: Amino acids are biomolecules that have an amino group and a carboxyl group attached to the same…

Q: Q3.2- In the Anfinsen protein folding experiment, removing urea and BME at the same time led to…

A: Anfinsen protein folding - is based on the thermodynamic protein folding hypothesis. It explain…

Q: Differentiate the four qualitative tests for proteins BIURET, XANTHOPROTEIC, NINHYDRIN, & MILLON’S

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Lipid movement showing migration of the lipid from one monolayer to another is called? flexion…

A: INTRODUCTION lipids - Energy-rich biomolecules made mostly from carbon and hydrogen atoms; generally…

Q: Inducers and Inhibitors of AEP. Short peptides such as legumain stabilization and activity…

A: Asparagine endopeptidase (AEP) is proteolytic enzyme (and also known as cysteine protease) which has…

Q: Describe the process of denaturation of protein.

A: A native protein conformation is only marginally stable. So most proteins must maintain…

Q: Match the following - Secreted by B cells of the pancreas ✓ Secreted in response to high blood…

A: PART 1 Pancreas is a gland and an organ,both at the same time. Glands are those organs which produce…

Question

2. Which of the following single-stranded DNA molecules are likely to pair with each other to form double-stranded molecules? You need to select two of the following. All are written in the5'-3' direction.

(a) GCTTAGCC

(b) TAGTGAAT

(d) ATTCACTA

(e) GCACGTAGG

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

1. Consider the following DNA segment: 5’….ATGCCCGATCAGAGCTTT…3” 3’….TAGGGGCTAGTCTCGAAA…5’ A. How many Phosphodiester bonds are required to form this segment of double-stranded DNA? B. How many hydrogen bonds are present in this DNA segment?
5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)
1. Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to direction?
1. In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called?
1. If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? 2. When DNA replicates, how is it able to “unwind” its double helix? 3. What are the types and major functions for each type of RNA?
1. Describe the three-dimensional structure of DNA.2. What is DNA denaturation?
5. The DNA sample in your final vial contains numerous strands of DNA ( 46 chromosomes from EACH cell lysed; and we hope hundreds of cells were lysed). Despite having all of this DNA present in your vial with the Master Mix, only one specific portion of your DNA will be amplified ; which part? How are we able to locate and copy just this region instead of accidentally copying other regions of DNA ?
2. If one strand of a DNA molecule has the base sequence5′-AGCATTAAGCT-3′, what is the base sequence ofthe other, complementary strand?
1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
7. Which of the following phosphates in a single-stranded DNA molecule is covalently attached to a carbon (in the deoxyribose sugar), but that phosphate is not part of a phosphodiester bond? the phosphate attached to the 5’-carbon on the first deoxyribose sugar of this single DNA strand the phosphate attached to the 5’-carbon on the last deoxyribose sugar of this single DNA strand the phosphate attached to the 3’-carbon on the first deoxyribose sugar of this single DNA strand the phosphate attached to the 3’-carbon on the last deoxyribose sugar of this single DNA strand all of the above
1) How many bases are found (on one of the strands) in a single twist of a DNA helix: a) 3.4 b) 10 d) 0.34 2)Which of the following is a correct representation of a segment of DNA: a) I b) I and III c) IV and V 3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3'Translated, the corresponding protein contains how many amino acids: a) 6 b) 7 c) 8
1) How many bases are found (on one of the strands) in a single twist of a DNA helix: a) 3.4 b) 10 c) 2 d) 0.34 2)Which of the following is a correct representation of a segment of DNA: a) I b) I and III c) IV and V d) V and I 3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3'Translated, the corresponding protein contains how many amino acids: a) 6 b) 7 c) 8 d) 13