Describe the three-dimensional structure of DNA. 2. What is DNA denaturation?
Q: "supercoiling" mean in the context of DNA structure? Define or explain the difference between…
A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…
Q: 5.State the contribution of the following scientists to the understanding of DNA structure: a)Erwin…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus control…
Q: 2. How are enzymes involved in this process? 3. What happens when DNA "unzips"? 4. Why is it…
A: This page contain link but that link is not opening so we are answering first 3 questions. For rest…
Q: 1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What…
A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…
Q: Explain the properties of THE DNA?
A: Biomolecules are the compounds that are necessary for different biological processes occurring in a…
Q: 17. Describe the Watson and Crick model of DNA structure.
A: DNA is the carrier of the genetic information from generation to generation.
Q: What’s Name and definition of the DNA?
A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…
Q: Give at least two differences between prokaryotic and eukaryotic DNAs
A: Prokaryotic cells do not possess membrane bound organelles and nucleus whereas, eukaryotic cell…
Q: Which of the following enzymes relaxes the DNA double helix to avoid tensional force from…
A: Polymerase enzymes synthesize polymers by adding monomer units through specific bonding patterns.…
Q: what is the significance of famous dna structure experiment?
A: The Hershey–Chase experiments were a series of experiments conducted in 1952 by Alfred Hershey and…
Q: If you will use apple or strawberries instead of banana do you think the result would be the same in…
A: All living things pass hereditary information from one generation to another using DNA as the basic…
Q: 1. Name the bonds that help to hold the two DNA strands together. 2. Name the three-dimensional…
A: 1) Hydrogen bonding 2) Double helix 3) 12 4) Complementary
Q: Chargaff’s rule states that the amount of _______ in DNA is always roughly equal to the amount of…
A: Introduction :- The Chargaff rule of base pairing and how the two strands of DNA are bound together…
Q: What would fit best for right properties of dna?
A: Introduction: DNA may be a chemical basis of heredity and will be thought to be the depository…
Q: 1. Which pieces of DNA are the most informative? Why?
A: as per our company guidelines we are supposed to answer only first 1question. Kindly repost other…
Q: If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases…
A: J.D Watson and F.H.C.Crick(1935) proposed a double helix model of DNA molecule, this is the widely…
Q: Describe the basic structure of a DNA? Give the different components of DNA and their function in…
A: Genetics is the branch of biology that deals with genetic material like DNA, RNA, inheritance.…
Q: Match the label on the left with the correct structure number in the DNA molecule in the image…
A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…
Q: 1. In the Central Dogma, what process involves the production of a new DNA strand using an old DNA…
A: Since you have asked multipart questions on the same topic, we will solve the first three questions…
Q: 19. You have reasonably short, typical, double stranded DNA sequence. Basically how many proteins…
A: DNA's molecular structure is referred described as a "double helix." Two connected strands that…
Q: 2. What shape/structure is DNA often described as? *
A: DNA is a nucleic acid present in the nucleus of eukaryotic cells. DNA is composed of many monomer…
Q: The final steps of DNA synthesis involve the removal and replacement of primers with DNA, and the…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: 4. DNA dissolves in water, but not in ethanol. Explain what happened when the ice cold ethanol came…
A: DNA is the genetic material and it is found in most organisms. DNA extraction is one of the first…
Q: 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each…
A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. A nucleotide is a…
Q: What is the purpose of cell dissolution? 2. What is the purpose of DNA separation? 3. What is the…
A: Cell lysis : The method in which the cell membrane is broken down to release the inter-cellular…
Q: Name three (3) structural features of the DNA and how they help the DNA perform its functions.
A: The abiotic evolution is also called the chemical evolution. This was the first kind of evolution…
Q: 1) Develop an analogy for the processes researchers use to make changes to DNA. In analogy, explain…
A: Nucleic acids are macromolecules composed of nucleotides (sugar, phosphate, and nitrogen base) bound…
Q: 1. When you simply look at the banding patterns on the gel from the DNA fingerprint we ran in lab as…
A: Gel electrophoresis is a molecular biology technique that is used commonly after DNA isolation to…
Q: Mention and explain 4 characteristics of the Structure of DNA.
A: DNA- Deoxyribose Nucleic Acid
Q: What are the 3 things DNA polymerase requires?
A: Deoxyribonucleic acid or DNA is a molecule that contains the genetic code of the organisms. DNA…
Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…
A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…
Q: olds the two strands of a DNA double helix together?
A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…
Q: 1. Based on Chargaff' s rules, if a segment of DNA is composed of 20% adenine (A) bases, what is the…
A: Chargaff 's rules state that the purines and pyrimidines bases should be in the ratio of 1:1 . In…
Q: 1. Two chains of DNA must run in directions and must be bond to each other. a. Opposite,…
A: Introduction DNA Is The Chemical Name For The Molecule In All Living Things That Conveys Genetic…
Q: How many genes are needed to sustain life? 2. Using a flow diagram, trace the history of the…
A: Introduction The genetic material in our cells is called DNA, or deoxyribonucleic acid. It…
Q: What is the composition of a DNA fragment that is what is a DNA fragment made of?
A: Nucleic acids are the essential macro molecules that carry and transmit genetic information in the…
Q: Draw the full structure of the DNA strand: 5'-ATG-3' To the above strand, draw the complementary…
A: Nucleic acid are the macromolecules which are of two types :- DNA and RNA DNA is deoxyribonucleic…
Q: 1. DNA is used to tell people apart. What aspects of DNA do you think make this possible? 2. What…
A: According to the questions, we have to provide the aspects of why DNA is used to tell people apart,…
Q: AKS 5a: Which of the following combinations is true of the nucleotide composition of a sample of…
A: DNA is a double helix with complementary nitrogenous bases making hydrogen bonds across the two…
Q: Which would you expect to have a higherentropy: DNA in its well-known double-helical form, or DNA…
A: Entropy is the measure of disorder in a system whereas it is considered as a measure of the…
Q: tate Chargaff’s rules. How did these rules help to discern the structure of DNA?
A: There are two types of nucleic acids, deoxyribonucleic acid or DNA and ribonucleic acid or RNA. Both…
Q: What are the features that make the structure of the DNA stable? Explain why the DNA is the genetic…
A: The 3Dimentional double-helical structure of DNA molecule was given by James Watson and Francis…
Q: Describe four differences between A and B forms of DNA
A: DNA is composed of four different types of nucleotides attached together via phosphodiester bonds.…
Q: Name 3 structural features of the DNA and how they help the DNA perform its functions
A: DNA is made up of four nitrogenous encode bases adenine ,guanine ,cytosine and thymine. These four…
1. Describe the three-dimensional structure of DNA.
2. What is DNA denaturation?
Step by step
Solved in 2 steps with 2 images
- 1. How does the DNA structure reflect its functions? 2. What are the important features of the DNA molecule?1. How can you modify your DNA model to reflect changes among DNA molecules? 2. How can a DNA molecule make an exact copy of itself?1. a) What does DNA stand for? b)What is the name of the DNA structure?
- 1. Describe the relationship between chromosomes, cells, and DNA2. [Use Pictures] - How does the model describe about the structure of DNA3. Why do scientists use models? What are the limitations of models?8 How natural processes can change the information stored in DNA?#4 under Identify the Structures is what? A. original strand of DNA B. DNA backbone C. nitrogen bases D. new complimentary strand of DNA
- #1 under Identify the Structures is what.... A. original strands of DNA B. backbone of DNA C. nitrogen bases D. new copied strand of DNA1. Define the primary structure of DNA/RNA. Compare and contrast to the primary structure of proteins.1.What are nucleic acids? What are their functions? 2.Illustrate and compare the primary and secondary structural levels of nucleic acids. 3.Name at least three applications of DNA analysis with full discussion of each.
- 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What if the DNA has 2.5 A260/A280 ratio?1. discuss the effect of temperature on the viscosity of the liquid 2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?
