Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is not metastable but fully stable DNA forms through a spontaneous, single step dehydration to form the sugar-phosphat backbone Pyrophosphate hydrolysis is a key step driving nucleoside polymerization The overall equation for DNA formation is: DNAN+NTP DNAN+1+H₂O Nucleotide diphosphates are the building blocks of polynucleotides

Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is not metastable but fully stable DNA forms through a spontaneous, single step dehydration to form the sugar-phosphat backbone Pyrophosphate hydrolysis is a key step driving nucleoside polymerization The overall equation for DNA formation is: DNAN+NTP DNAN+1+H₂O Nucleotide diphosphates are the building blocks of polynucleotides

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Similar questions

Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
Can somone check my answers are in bold please for both questions :Which is NOT true of the different conformations of DNA? A. Z-DNA is a left-handed spiral. B. Both A-DNA and B-DNA are dehydrated. C. A-DNA and B-DNA are right-handed spirals. D. A-DNA and Z-DNA segments are limited to short regions of DNA. For double-stranded DNA, consider the following base ratios: A/G C/T C/G (A+C)/(G+T) (A+G)/(C+T) (A+T)/(G+C) Which of those ratios always equals 1? A. 3, 4, and 5 B. 3 and 6 C. 1, 4, and 5 D. 4 and 6 E. 1 and 2
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
Is it unusual that the -subunits of DNA polymerase III that form a sliding clamp along the DNA do not containthe active site for the polymerization reaction? Explain your answer.
T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
Agarose gels with different average pore sizes areneeded to separate DNA molecules of different sizeclasses. For example, optimal separation of 1100 bpand 1200 bp fragments would require a gel with alarger average pore size than optimal separation of8500 bp and 8600 bp fragments. How do you thinkthat scientists prepare gels of different average poresizes? (Hint: Agarose gels are made in a mannersimilar to gelatin desserts such as JELL-O.)