Which of the following statements are TRUE for dynamic memory allocation? I. Dynamic memory allocation is done by using new operator II. Dynamic memory deallocation is done by using delete operator III. Operator new calls the destructor IV. Operator delete calls the constructor Select one: a.l and II b.lIl and IV c.Only I O d.Only II

Which of the following statements are TRUE for dynamic memory allocation? I. Dynamic memory allocation is done by using new operator II. Dynamic memory deallocation is done by using delete operator III. Operator new calls the destructor IV. Operator delete calls the constructor Select one: a.l and II b.lIl and IV c.Only I O d.Only II

Name: Which of the following statements are TRUE for dynamic memory allocat
Uploaded: 2024-03-20T06:51:23.000Z
Channel: Bartleby
Description: Which of the following statements are TRUE for dynamic memory allocation?I. Dynamic memory allocation is done by using new operatorII. Dynamic memory deallocation is done by using delete operatorIII. Operator new calls the destructorIV. Operator del

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter12: Points, Classes, Virtual Functions And Abstract Classes

Section: Chapter Questions

Problem 1TF

See similar textbooks

Similar questions

4) Which of the following is/are valid ways to allocate memory for an integer by dynamic memory allocation in CPP? a. int *p = new int(100);b. int *p; p = new int; *p = 100;c. int *p = NULL; p = new int; *p=100;d. Only 1,2e. All of these 5) Choose the correct option?#include<iostream>using namespace std; class Base {}; class Derived: public Base {}; int main(){Base *bp = new Derived;Derived *dp = new Base;} a. No Compiler Errorb.Compiler Error in line “Base *bp = new Derived;”c. Compiler Error in line ” Derived *dp = new Base;”d. Runtime Error
Question 10 Which statement of the following is the most appropriate? Group of answer choices In C++, the allo operator is used to allocate dynamic memory. The delete operator is used to free dynamic memory. In C++, the new operator is used to allocate dynamic memory. The delete operator is used to free dynamic memory. In C++, the new operator is used to allocate dynamic memory. The clean operator is used to free dynamic memory. In C++, the allo operator is used to allocate dynamic memory. The clean operator is used to free dynamic memory.
1)Answer the question with the correct option A) Which of the following assigns to the pointer p to the address of value? options are given p = value; *p = &value; p = &value; p = &value;
To use dynamic memory allocation functions, which of the following header files must be included?a) stdlib.hb) stdio.hc) memory.hd) dos.h
Q1. What is the difference between static and extern storage class? Give suitable examples in support of your answer. Q2. Write a program to take input for a number, if the number is palindrome, then display its half on the screen, otherwise take input for 2 more numbers, and display their product on the screen. Use minimum two functions including main function
Which of the following is/are valid ways to allocate memory for an integer by dynamic memory allocation in CPP? a. int *p = new int(100); b. int *p; p = new int; *p = 100; c. int *p = NULL; p = new int; *p=100; d. Only 1,2 e. All of these
With the code below,dynamic memory allocation is not utilized at the main function. Rewrite the main function to incorporate dynamic allocation. #include<iostream>using namespace std;class Student{private:string studid, name; float marks[2], average;public:void setInput(){cout<<"Please enter student id :";getline(cin,studid);cout<<"Please enter name :";getline(cin,name);cout<<"\n\n";}void setMarks(){for(int i=0;i<2;i++){cout<<"Please enter mark for quiz "<<(i+1)<<" :";cin>>marks[i];calculate_average();} }void calculate_average(){float total;for(int i=0;i<2;i++){total += marks[i];}average = total / 2;}friend void display_info(Student);};void display_info(Student s){cout<<"\n\n\n>>>>>>>>>>>>>>>>>>>>>>>>>>>>"<<endl;cout<<" Result Score "<<endl;cout<<"----------------------------"<<endl;cout<<"ID Name Average…
You are required to make changes in the below programs and introduce the use of compaction where required. #include<stdio.h> #include<conio.h> #define max 25 void main() { int frag[max],b[max],f[max],i,j,nb,nf,temp,lowest=10000; static int bf[max],ff[max]; clrscr(); printf("\nEnter the number of blocks:"); scanf("%d",&nb); printf("Enter the number of files:"); scanf("%d",&nf); printf("\nEnter the size of the blocks:-\n");for(i=1;i<=nb;i++) printf("Block %d:",i);scanf("%d",&b[i]); printf("Enter the size of the files :-\n");for(i=1;i<=nf;i++) { printf("File %d:",i); scanf("%d",&f[i]); } for(i=1;i<=nf;i++) { for(j=1;j<=nb;j++) { if(bf[j]!=1) { temp=b[j]-f[i];if(temp>=0) if(lowest>temp) { ff[i]=j; lowest=temp; } } } frag[i]=lowest; bf[ff[i]]=1; lowest=10000; } printf("\nFile No\tFile Size \tBlock No\tBlock Size\tFragment"); for(i=1;i<=nf && ff[i]!=0;i++) printf("\n%d\t\t%d\t\t%d\t\t%d\t\t%d",i,f[i],ff[i],b[ff[i]],frag[i]); getch();…
do some changes in code and make it unique #include <stdio.h>#include <stdlib.h>#include<string.h>//declaring functionsvoid firstFit(int [], int , int [],int );void bestFit(int [], int , int [],int );void worstFit(int [], int , int [],int );//starting programint main() {//declare partitions and processint partitions [] = {110, 450, 100, 250, 500};int processes [] = {212, 417, 112, 426};//getting their sizesint size_partitions = sizeof(partitions )/sizeof(partitions [0]);int size_processes = sizeof(processes )/sizeof(processes [0]);printf("Partitions size: ") ;for (int i=0; i<size_partitions; i++){printf("%d\t" ,partitions[i] );}//index partprintf("\nPartitions index: " );for (int i=0; i<size_partitions; i++){printf("%d\t" ,(i+1)) ;}printf( "\n" );// calling functionsfirstFit(partitions , size_partitions, processes , size_processes);bestFit(partitions , size_partitions, processes , size_processes);worstFit(partitions , size_partitions, processes ,…
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
How would I write these functions in C? Write the function multiThreads to do the followinga. Return type voidb. Empty parameter listc. Declare a constant of data type int to store the number of threadscreated (i.e. SIZE) set equal to 7 (seven)d. Declare a looping variable of data type int (i.e. i)e. Declare a variable of data type int to store the return value fromfunction pthread_create (i.e. error)f. Declare a variable of data type pthread_t as an array (i.e. tid), size7 (i.e. SIZE) g. Loop SIZE times to do the followingi. Set variable error equal to function call pthread_create ()passing as arguments1. The address of the element in thread array tid[i]2. NULL3. The address of function threadFunction4. Explicit type cast (void *) of the address of theelement in thread array tid[i]ii. Evaluate if variable error is not equal to 0 (i.e. indicatingthe thread could not be created)1. Output to the console explicit text2. "\nThread can't be created : [%s]" “Press `Enter' tocontinue .…
You are required to make changes in the below programs and introduce the use of compaction where required. #include<stdio.h> #include<conio.h> main() { int ms, bs, nob, ef,n, mp[10],tif=0; int i,p=0; clrscr(); printf("Enter the total memory available (in Bytes) -- "); scanf("%d",&ms); printf("Enter the block size (in Bytes) -- "); scanf("%d", &bs); nob=ms/bs; ef=ms - nob*bs; printf("\nEnter the number of processes -- "); scanf("%d",&n); for(i=0;i<n;i++) { printf("Enter memory required for process %d (in Bytes)-- ",i+1); scanf("%d",&mp[i]); } printf("\nNo. of Blocks available in memory -- %d",nob); printf("\n\nPROCESS\tMEMORY REQUIRED\t ALLOCATED\tINTERNAL FRAGMENTATION"); for(i=0;i<n && p<nob;i++) { printf("\n %d\t\t%d",i+1,mp[i]); if(mp[i] > bs) printf("\t\tNO\t\t---"); else { printf("\t\tYES\t%d",bs-mp[i]);tif = tif + bs-mp[i]; p++; } } if(i<n) printf("\nMemory is Full, Remaining Processes cannot be accomodated"); printf("\n\nTotal…