Which of the following statements regarding "start" and "stop" signals apply to both transcription and translation? the start and stop signals are "read" (i.e., interpreted) the start and stop signals reside within nucleic acid the start and stop signals are part of the genetic code the start and stop signals reside in RNA. start and stop signals are needed because the products must have a definite length and sequence.

Which of the following statements regarding "start" and "stop" signals apply to both transcription and translation? the start and stop signals are "read" (i.e., interpreted) the start and stop signals reside within nucleic acid the start and stop signals are part of the genetic code the start and stop signals reside in RNA. start and stop signals are needed because the products must have a definite length and sequence.

Name: More than one answer can be correct Which of the following statements
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: More than one answer can be correct Which of the following statements regarding "start" and"stop" signals apply to both transcription andtranslation?the start and stop signals are "read" (i.e., interpreted)the start and stop signals reside within nuc

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Mark the point at which transcription will terminate
Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? Sigma Start codon Promoter Primer
The sigma factor protein's role in transcription in E. coli includes which of the following? None of the answer options are correct. plays a role in transcription termination forms part of the core enzyme required for transcription initiation helps the siRNA to bind to the promoter All of the answer options are correct. contributes to the proof-reading activity of RNA polymerase And The role of tRNA is to serve as an intermediate in the decoding of genes. serve as general translational components of the ribosome. facilitate protein trafficking in protein secretion. facilitate splicing of pre-messenger RNAs. act as vehicles bringing amino acids to the site of protein synthesis. None of the answer choices are correct.
The most common type of termination signal in E. Coli is a symmetrical inverted repeat of GC rich sequences followed by about 7 As that forms a stable stem-loop structure in the RNA, which disrupts its association with the DNA template and terminates transcription. true or false
Which of the following types of RNA-based regulation may affect the expression of a target gene during translation (meaning, transcription is unaffected)? Choose all that apply. Group of answer choices riboswitch asRNA miRNA siRNA attenuation
Which of the following mechanisms may create multiple mRNAsfrom the same gene?a. posttranslational controlb. alternative mRNA splicingc. binding of a transcription factord. chromatin remodelinge. miRNAs
Which of the following statements regarding complementary molecules in transcription is false? Group of answer choices The sense strand is complementary to the template strand The transcribed RNA is complementary to the noncoding strand The coding strand is complementary to the antisense strand The transcribed RNA is complementary to the coding strand
Which of the following components is involved in the initiation of transcription? Group of answer choices promoter primer start codon origin
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q.Where, approximately, will the transcription start site be?
Which of the following base sequences is used during transcription? a. Promoter and terminator b. Start and stop codons c. Ribosome-binding site d. Both a and b
Which of the following is true only for eukaryotic gene expression? mRNA is synthesized in the 3' ---> 5' direction. Translation of mRNA routinely begins before transcription is complete. The mRNA transcript is the exact complement of the gene from which it was copied. After transcription, a 3' poly-A tail and a 5' cap are added to mRNA. RNA polymerase binds to the promoter region to begin transcription.
A particular mutation in the bacterial sigma factor allows this protein to bind RNA polymerase but prevents it from coming off (detaching) RNA polymerase once it binds. What specific effect will this mutation have on transcription? It will prevent the transcription termination exerted by the Rho protein. It will prevent the formation of closed complexes between RNA polymerase and the promoter. It will prevent the formation of open complexes between RNA polymerase and the promoter. It will prevent the transition from the transcription initiation to the transcription elongation stage. It will prevent the synthesis of abortive RNA transcripts while the RNA polymerase is bound at the promoter.