Which of these plates are the control plates? What purpose does a control plate serve?On which plates did you expect to find transformants?Explain what a single colony represents on the petri dish labeled + LB/AMP. PlateLB-PlasmidLB + PlasmidLB/amp - PlasmidYesYesNo+ LBLB/amp + Plasmid YesLBPredictionReesonPlate only contains Yesfood/bacteriaPlate only contains Yesfood/bacteriaBacteria will bekilled by ampicillinBacteria hasampicillinresistanceLBClick on pic to zoom Click on pic to zoom-LBObserved ResultNoYeschlampxClick on pic to zoom+ LB/AMPBlampClick on pic to zoom- LB/AMP

Name: Which of these plates are the control plates? What purpose does a con
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of these plates are the control plates? What purpose does a control plate serve?On which plates did you expect to find transformants?Explain what a single colony represents on the petri dish labeled + LB/AMP. PlateLB-PlasmidLB + PlasmidLB/amp

Transformation is the process of inserting the desired gene in to bacteria through plasmid and let…

Science

Biology

Which of these plates are the control plates? What purpose does a control plate serve? On which plates did you expect to find transformants? Explain what a single colony represents on the petri dish labeled + LB/AMP.

Which of these plates are the control plates? What purpose does a control plate serve? On which plates did you expect to find transformants? Explain what a single colony represents on the petri dish labeled + LB/AMP.

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 5DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
biotechnology lab class :1. The bacterial streaking on antibiotic containing agar plates has been completed and the plates will be available for you to inspect in the lab class.2. You will complete a restriction enzyme digest on the four available plasmid stocks and then examine the products by agarose gel electrophoresis. Photographs of the gel are attached to identify the plasmid present in each analysed sample.Now consider the following questions :- For each of the four plasmids used in the practical, identify the size (in kb) of the linear DNA fragment(s) that you would expect to obtain if the EcoRI digest is complete.- Using the provided negative image of the gel, which shows the bands present in the ND and D samples for each plasmid, identify the plasmid that was present in each of the four plasmid stock.- Explain how you were able to identify plasmid in each sample using the gel, considering how linear DNA fragments of different length are separated by agarose gel…
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. How did the researchers know that the radioisotopes in the fluid came from outside of the bacterial cells and not from bacteria that had been broken apart by whirling in the blender?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. After 4 minutes in the blender, what percentage of each isotope was extracellular?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. The extracellular concentration of which isotope increased the most with blending?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Before blending what percentage of each isotope. 35S and 32P, was extracellular (outside the bacteria)?
HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed 10 infect bacteria. The virusbacteria mixtures were then whirled in a blender to dislodge any viral components attached to the exterior of the bacteria. Afterward, radioactivity from the tracers was measured. FIGURE 8.5 Detail of Alfred Hershey and Martha Chases 1952 publication describing their experiments with bacteriophage. Infected bacteria refers to the percentage of bacteria that survived the blender. Do these results imply that viruses inject DNA or protein into bacteria? Why or why not?
Sequence of which of the following cannot be determined using the Maxam Gilbert method?a) Bacteriab) Plantsc) Bacteriophage T7d) Plasmid
Please answer the following using the experiment data below. Provide the formulas or methods used for calculations of each. Number of colonies on LB/amp/ara plate = Micrograms of DNA spread on the plates = Transformation efficiency = DNA plasmid concentration: 0.08 μg/μl 250 μl CaCl transformation solution 10 μl pGLO plasmid solution 250 μl LB broth 100 μl cells spread on agar 227 colonies of transformants
profile-image If you take a DNA photolyase- strain of E. coli, and subject it to the treatment below step 1, spread evenly on LB plate step 2, subject to UV light step 3, cover half of plate and grow in light What will be the most likely outcome if the level of UV is nearly lethal to cells on the plate? a. Only colonies on uncovered side of plate b. Only colonies on covered side of plate c. very few colonies in roughly equal numbers on both sides of plate
What conditions are making bacteria competent to taking up a foreign plasmid? Please answer asap
Conjugation using ________ will result in the transmission of a segment of chromosomal DNAfrom one host to another using a plasmid. Question 25 options: F‑strain High frequency recombination (hfr) strain F+strain F plasmid F' plasmid