Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.

Which statements are true? Explain why or why not.1 In terms of the way it interacts with DNA, thehelix–loop–helix motif is more closely related to the leu-cine zipper motif than it is to the helix–turn–helix motif.2 Once cells have differentiated to their final spe-cialized forms, they never again alter expression of theirgenes.3 CG islands are thought to have arisen during evo-lution because they were associated with portions of thegenome that remained unmethylated in the germ line.4 In most differentiated tissues, daughter cells retaina memory of gene expression patterns that were presentin the parent cell through mechanisms that do not involvechanges in the sequence of their genomic DNA.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 6P

See similar textbooks

Similar questions

#22) You have identified five genes in S. cerevisiae that are induced when the yeast are grown in a high-salt (NaCl) medium. To study the potential roles of these genes in acclimation to the growth in high-salt conditions, you wish to examine the phenotypes of loss-and-gain-of-function alleles of each. How will you do this?
33. For the following gene, which type of regulatory sequence has likely been deleted in mutant 1?
Which statements are true? Explain why or why not.1 The chemical carcinogen dimethylbenz[a]anthra-cene (DMBA) must be an extraordinarily specific mutagensince 90% of the skin tumors it causes have an A-to-T alter-ation at exactly the same site in the mutant Ras gene.2 In the cellular regulatory pathways that controlcell growth and proliferation, the products of oncogenesare stimulatory components and the products of tumorsuppressor genes are inhibitory components.3 Cancer therapies directed solely at killing the rap-idly dividing cells that make up the bulk of a tumor areunlikely to eliminate the cancer from many patients.4 The main environmental causes of cancer are theproducts of our highly industrialized way of life such aspollution and food additives.
1. enzymes that catalyze histone acetlation are closesly associated with transription factors, which are proteins that promote transcription. why is this a good biochemical strategy? 2. sp1 is a sqeuence specific human DNA binding protein that binds to a region on the DNA called the GC box, a promoter element with the sequence GGGCGG. Binding of Sp1 to the GC box enhances RNA polymerase 2 activity 50- to a 100 fold. How would you use affinity chromatography to purify SP1?
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
Pls answer ASAP. Sec61 is a protein involved in the formation of the translocon for ER-targeted proteins. What would happen to the proteins targeted to the Golgi Apparatus in a mammalian cell in which the Sec61 is mutated?
64. Embryonic stem (ES) cells differ from somatic stem cells in that ... a) ES cells can only be derived from early embryos, whereas somatic stem cells are present in adult tissues. b) ES cells retain the ability to renew themselves, whereas somatic stem cells do not. c) ES cells are pluripotent and can differentiate into any cell type in the developing embryo, whereas somatic stem cells are considered multipotent in that they produce a more limited number of differentiated cell types. d) a and c e) a, b and c
David Seligson and his colleagues examined levels of histone proteinmodification in prostate tumors and their association with clinicaloutcomes (D. B. Seligson et al. 2005. Nature 435:1262–1266). Theyused antibodies to stain for acetylation at three different sites and formethylation at two different sites on histone proteins. They found that the degree of histone acetylation and methylation helped predict whetherprostate cancer would return within 10 years in the patients who had aprostate tumor removed. Explain how acetylation and methylation mightbe associated with tumor recurrence in prostate cancer.
In addition to Tc1, the C. elegans genome contains otherfamilies of DNA transposons such as Tc2, Tc3, Tc4, andTc5. Like Tc1, their transposition is repressed in thegerm line but not in somatic cells. Predict the behaviorof these elements in the mutant strains where Tc1 is nolonger repressed due to mutations in the RNAi pathway.Justify your answer.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
1. Peroxisomes are organelles surrounded by a single membrane. Soluble proteins that reside within peroxisomes are imported post-translationally, and they often contain the C-terminal tripeptide SKL (serine-lysine-leucine). a. How would you confirm that a C-terminal SKL tripeptide is a peroxisomal targeting signal? b. If cells were engineered to produce a hybrid protein consisting of a mitochondrial matrix protein (including its signal sequence) followed by a C-terminal SKL signal, where in the cell would you expect the hybrid protein to be found? Explain your reasoning. 2. Functional mitochondria can be isolated from cells. These isolated mitochondria are used to study oxidative phosphorylation and the import of proteins into the matrix. In an appropriate buffer, isolated mitochondria will rupture to generate “mitoplasts” in which the inner membrane remains intact but the outer membrane is lost. Would you expect mitoplasts to support oxidative phosphorylation?…
12. a. You want to create a genetic construct that will express GFP in Drosophila. In addition to the GFPcoding sequence, what DNA element(s) must youinclude in order to express this protein in flies if theconstruct were integrated into the Drosophila genome? Where should such DNA element(s) be located? How would you ensure that GFP is expressedonly in certain tissues of the fly, such as the wing?b. Suppose you insert the GFP coding region plus allof the DNA elements required by the answer to part(a)—except the enhancer—between inverted repeatsfound at the ends of a particular transposable element.Because all of the DNA sequences located betweenthese inverted repeats can move from place to placein the Drosophila genome, you can generate manydifferent fly strains, each with the construct integrated at a different genomic location. You now examine animals from each strain for GFPfluorescence. Animals from different strains showdifferent patterns: some glow green in the eyes,others in…