Elaborate on the oviposition process of female turtles. Provide the pathways included in the oviposition process

Q: Inside a body, this reaction has a value of positive ∆G   C6H12O6 + H3PO4 → C6H14O12P2 + H2O ∆G=…

A: For any reaction to keep going in the forward direction it needs to have negative value of ∆G. It is…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: In eukaryotic gene regulation, the Mediator complex mediates interactions between: The preinitiation…

A: Mediator complex found in Drosopila , mammals and yeaat.  It interact with transcription factor…

Q: write 5 Neurological tests of the spine,5 tests for the spinal joints and 5 special tests of the…

A: A neurological exam, sometimes known as a neuro exam, is a test that evaluates a person's nervous…

Q: Name the phases of the cell cycle.  b) During which phases are the chromosomes and then the…

A: Cell cycle  Cell cycle is a division of cell takes place in various steps and divide one cell into…

Q: Full or partial limblessness has evolved many times invertebrates (snakes, lizards, manatees,…

A: Evolution is the process of change over time, typically involving gradual changes that lead to new…

Q: 32. The lines in the palm that crease when the thumb opposes the other digits are an example of:…

A: Lines on the plam :  The lines present on the body are called the palmar flexion creases. These…

Q: Genetics. How to identify what wrong with it

A: DNA sequencing refers to the overall lab strategy for deciding the specific sequence of nucleotides,…

Q: Hb oxygen binding capacity

A: Hemoglobin : Then red protein responsible for transporting oxygen in the blood of vertebrates. its…

Q: An outbreak of Methicillin-resistant Staphylococcus aureus (MRSA) in the surgical ward at the…

A: A fluid sample is taken from  wound, nose, blood or urine.  The cobas vivoDx MRSA test uses a new…

Q: Summarize the importance of fungi to biology and medicine; describe how fungi infect plants and…

A: Introduction Fungi are eukaryotic organisms. They can reproduce sexually as well as asexually by…

Q: What are the roles of the innate immune system? Select all that apply.   A. identity self vs.…

A: Pathogens are disease-causing organisms that can cause humans to become ill or die depending on the…

Q: Osmosis, the diffusion of water is distinct from the diffusion of oxygen because a) oxygen is a…

A: Osmosis, the diffusion of water is distinct from the diffusion of oxygen because?

Q: Biology why do plants closer to water have a larger xylem diameter and higher hydraulic…

A: Climate, water supply, weather patterns, soil nutrients and soil characteristics, availability of…

Q: List distinguishing characteristics, describe a typical life cycle, and give examples of each of the…

A: Fungus (plural fungi) are any of the around 145,000 known species of fungi, including includes…

Q: After decades of work, Dr. Ricky M. isolated a small amount of attractase—an enzyme that produces a…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: hair, underdeveloped nails, and abnormally shaped eyelids. In the following pedigree, which…

A:

Q: providing at least TWO specific examples of advances that took place in the last 150 years that…

A: Life expectancy is the average life span or the average years a person can live. On an average,…

Q: Our conception of the gene has developed during the last century and a half from a "factor' somehow…

A: We all know that genes are the basic units through which the inheritance is possible. This ensures…

Q: 7) The protein VEGF plays an important role in stimulating the formation of new blood vessels. In…

A: VEGF ( vascular endothelial growth factor ) is responsible for the growth of new vessels. In…

Q: Match the concept in column A to the concept in column B. Write the letter of the correct answer on…

A: Ans: Amino acids are C - terminus and N -terminus.  2.  In endoplasmic reticulum, attachment of…

Q: The PCR process has 4 steps :collection, preparation, amplification, and post PCR clean-up. The PCR…

A: PCR stands for Polymerase Chain Reaction. PCR is a technique used to rapidly amplify specific…

Q: Why is tooth structure important in the study of mammals

A: Mammals are heterodont, that implies they have a variety of teeth that serve specialised or distinct…

Q: 9. The sister chromatids begin to coil more tightly and become visible under a light microscope…

A: DISCLAIMER Since you have asked multiple questions, we will solve the first question for you. If you…

Q: Fungi are (a) eukaryotes and opisthokonts (b) prokaryotes and opisthokonts (c) flagellate and…

A: Introduction :- Fungi are eukaryotic organisms that are non-vascular, non-motile, and heterotrophic.…

Q: Characterize the unique nature of a lichen.

A: Introduction A lichen is a symbiotic connection between two organisms, a green alga or…

Q: The individual flattened stacks of membranous structures inside the chloroplasts are known as : (A)…

A: Introduction - A chloroplast is an organelle found within the cells of plants and algae that is…

Q: 8) Capillary electrophoresis involves a) Fragmentation of the DNA strands b) High resolution…

A: Capillary electrophoresis is an experimental methodology that provides an applied voltage to…

Q: Each enzyme is able to promote only one type of chemical reaction. The compounds on which the enzyme…

A: A. Temperature- The rate of an enzyme-catalyzed reaction rises as the temperature rises, as it does…

Q: How does the nervous system and the endoctrine system work together to coordinate body functions

A: Endocrine glands are ductless glands that secrete into the bloodstream. Endocrine glands include the…

Q: In a genetic system of complete dominance, a recessive allele is expressed    Select one: A.…

A:

Q: If both parents have blood types tha are both A+, which children are likely?

A: Answer :   If both parents have blood types tha are both A+, children are likely to have either A+…

Q: Propose a synthesis for the compound below from benzene. Please add explanation of the steps.

A: Benzene is a cyclic organic compound that helps in several processes and necessary stuff. It is also…

Q: Describe how the reading Prime Time describes the various aspects of time that older adults posses…

A: Cultivating and harness is the method to make productive own lands . It consume time and hardwork to…

Q: The cytoskeleton consists of many parts, but NOT O a) Intermediate filaments O b) microtubules c)…

A: Introduction :- Except for bacteria and archaea, the cytoskeleton is a complex, dynamic network of…

Q: In order to ensure your newly designed peptide vaccine does not cause cell growth upon binding, you…

A: Melanoma is a kind of skin disease that creates when melanocytes (the cells that give the skin its…

Q: Fill in the following with the correct words about cloning (the first blank will be the first word…

A: Cloning In simple terms, the term cloning is derived from the word "clone" which means "exact copy",…

Q: how does a bacteria cell protect its self from a viral attack? Bacteria mark their own DNA Bacteria…

A: Bacteria are single-celled, simple organisms that cannot be seen with the naked eye. Bacteria can be…

Q: 1. Name the molecule that contributes to the shape of a capsid around a virus?

A: The capsid is basically a protective layer around the viral structure which usually protects the…

Q: What are examples of endogenous and exogenous enzymes and how do they work (what are they…

A: Enzymes are proteins which assist our systems accelerate chemical reactions. Enzymes are necessary…

Q: The selection of a specific promoter to activate during mRNA synthesis is determined by:

A: The selection of specific promoter is achieved by the set of specific transcription factors in the…

Q: Summarize some specific ways that fungi affect humans economically.

A: Study of fungi is defined as Mycology.Fungi are heterotrophs that absorb nutrients.Fungi are…

Q: 3. Identify key flower structures and describe differences between flower and pollen structures in…

A: Flowers are the reproductive portions of the plant, their fundamental function is reproduction. Many…

Q: In a study, Şpraque-Dawley rats were infected with P. multocida type B2 and various characteristics…

A: Peyers patches count in grows examination for the normal rats is 90 and for infected rats it is 100

Q: The mineral ion needed for the formation of blood clot is : (A) Potassium (B) Sodfrym (C) Calcium…

A: Introduction - A blood clot is a collection of platelets, proteins, and cells that cling together in…

Q: According to Charles Darwin, organic evolution is "descent with modification," which simply means…

A: Charles Darwin, a British naturalist proposed the theory of organic evolution by natural selection.…

Q: Compare and contrast both the structure, AND the molecular mechanisms of the Moderna/Pfizer Covid-19…

A: The Pfizer-BioNTech vaccine (brand name: Comirnaty) was granted full Food and Drug Administration…

Q: Central Dogma Application: Using the basic concept of Process of central dogma provide the following…

A: Replication is the process of making two identical DNA molecules from a double-stranded DNA…

Q: Which of the following does NOT apply to genetic drift? O is not determined by beneficial traits can…

A: Genetic drift is the spontaneous variation in the frequencies of a preexisting genetic variant in a…

Q: You are attempting to produce a recombinant virus. Your virus vector has ampicillin resistance. Your…

A: Introduction :- Reporter Genes and Recombinant Viruses Recombinant viruses are created by…