9 O e. all of the aboveQUESTION 9Which structure is responsible for translating MRNA?a. RNA Polymerase IO b. RNA polymerase IO c. Primased. None of the given answersO e. DNA Polymerase IIQUESTION 10Of the proteins listed below, choose all of those that are part of the basal transcripticO RNA Polymerase II

Name: 9 O e. all of the aboveQUESTION 9Which structure is responsible for tr
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 9 O e. all of the aboveQUESTION 9Which structure is responsible for translating MRNA?a. RNA Polymerase IO b. RNA polymerase IO c. Primased. None of the given answersO e. DNA Polymerase IIQUESTION 10Of the proteins listed below, choose all of those th

Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…

Answered: Which structure is responsible for…

Science

Biology

Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O c. Primase O d. None of the given answers O e. DNA Polymerase II

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and b
A binding .site for RNA polymerase is called a ___ . a. gene b. promoter c. codon d. protein
1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA is not used directly for protein translation (i.e., why is mRNA used instead?).c. Explain what occurs when a gene’s promoter region is open for RNA polymerase binding.d. Explain what occurs when a gene’s promoter regions is blocked from binding RNA polymerase.e. Explain how two cells, such as liver cells and skin cells, can become specialized in structure and function despite containing the same genome.
Several temperature-sensitive mutant strains of E. coli displaythe following characteristics. Predict what enzyme or functionis being affected by each mutation.(a) Newly synthesized DNA contains many mismatchedbase pairs.(b) Okazaki fragments accumulate, and DNA synthesis is nevercompleted.(c) No initiation occurs.(d) Synthesis is very slow.(e) Supercoiled strands remain after replication, which isnever completed.
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?
5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.
91The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yesorno 92Core polymerase (α2ββ’) use intact double-stranded DNA as a template. Yesorno 93Protein synthesis machinery reads the mRNA nucleotide sequence in groups of three bases or ______________. A.operatorsb.codonsc.open reading framesD.operons
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNA