Q: Draw the structure of the amino acid arginine and indicate all ionizable groups
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four…
Q: How many of the amino acid N are there in this structure?
A: Daptomycin is a cyclic lipopeptide antibiotic. It is used for treating skin infections, right-sided…
Q: how can you determine if a protein sequence is functional using amino acids?
A: A protein is a polymer of amino acid. The primary structure of protein begins with the amino…
Q: What are the subunits that nucleic acids are made of? Briefly explain the difference between DNA and…
A: Macromolecules are vital structures that perform various roles in the human body. They are broadly…
Q: How many nucleotides are needed to code for a protein with 500 amino acids?
A: Amino acids are encoded by a set of three consecutive nucleotides known as a codon. One codon codes…
Q: Uracil is nitrogenous base and nucleosides?
A: Ribonucleic acid (RNA) and Deoxy ribonucleic acid (DNA) is the genetic material of most organisms…
Q: What do 3' and 5' ends of nucleic acids refer to ?
A: The structure of the nucleic acid is given below:
Q: Identify the ff nucleic acid bases and then classify whether it is a purine or pyrimidine.
A: Nucleic acids are also known as polynucleotides. Monomeric units of nucleic acids are called…
Q: What is the function of the structure labeled A?
A: Annelids are bilaterally symmetrical(can be divided into two equal segmants), triploblast(have three…
Q: How did nucleic acid synthesis (which requires many protein enzymes) and protein synthesis (which…
A: Nucleic acid synthesis is a process, during which new DNA is synthesized from the parental DNA…
Q: (a) Identify the base and monosaccharide in the following nucleotide. (b) Give the name and three-…
A: Nucleotides are the building blocks of nucleic acids which are the organic molecules that are…
Q: Why are gyrase and helicase required?
A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two DNA…
Q: Where do terms 5’, 3’ in nucleic acids come from?
A: DNA and RNA are nucleic acids tht are present in cells serving functions such as the carrier of…
Q: List the three components of a nucleotide.
A: Nucleotide: It is the basic unit of DNA and have 3 components- a Nitrogenous base, a pentose…
Q: Name the enzyme which helps in formation of peptide bond?
A: The peptide bond is a chemical bond and is formed when the carboxyl group of one molecule reacts…
Q: Draw out the structural formula of the oligopeptide, with the first amino acid as the N-terminus
A: Amine and carboxylic acid groups in amino acids are joined together, and forms chains of amino acids…
Q: Is the sugar in the nucleotide deoxytibose or ribose? How do you know?
A: DNA/RNA is made up of monomers of nucleotides .
Q: Why is hydrolysis of a protein not considered to be denaturation?
A: Hydrolysis is a chemical process in which a molecule of water is added to a substance. Sometimes…
Q: Why is the exact order of amino acids (primary structure) in a protein important?
A: Amino Acids : Amino acids are organic compounds that combine to form proteins. Amino acids and…
Q: Which type of bonds exist between paired nitrogenous bases?
A: Nitrogenous bases are the monomers that join to form the genetic material. The nitrogenous bases in…
Q: Would the peptide group be planar if the amino group of amino acids was bonded to the β carbon of…
A: Peptide group is generally linked to the amide bond that links the α-amino nitrogen of one amino…
Q: Draw out the structural formula of the oligopeptide, with the first amino acid as the N-terminus.
A: 1. Protein primary source is linear sequence of amino acids in peptide or protein. Primary…
Q: Which are the nucleotides "portions" that bind in the formation of nucleic acids? What is meant by…
A: The term nucleic acid is associated with the biomolecule that plays an important role in storing as…
Q: Describe the structure of a nucleotide and the general structureof a nucleic acid.
A: Nucleic acid and nucleotides are essential components of DNA and RNA (genetic material). The…
Q: Describe base pairing
A: DNA (deoxyribonucleic acid) is a double helix structure with two strands that travel in opposite…
Q: If YES, DNA is another nucleic acid, can this be hydrolyzed by an acid? what are the products…
A: DNA is a nucleic acid and nucleic acids are the polymers of nucleotides. Nucleotide contains…
Q: glutamic acid were replaced by proline in a protein
A: Glutamic acid is a hydrophilic amino acid whereas proline is hydrophobic. The polar acid R group of…
Q: What constitutes the backbone of a nucleic acid?
A: Introduction: A nucleic acid is a biological large molecule composed of nucleotide chains. These…
Q: The base sequence of which type of RNA is responsiblefor determining the order of amino acids in a…
A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…
Q: What base is missing in RNA and what base replaces it?
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Is oligonucleotide a protein?
A: The nucleotide is a building block of nucleic acids that is DNA and RNA. The base, phosphoric acid,…
Q: Do Carbohydrates Provide a Structural Code?
A: Carbohydrates are biomolecules that consist of carbon, hydrogen, and oxygen. these are the major…
Q: Name the nucleic acid
A: DNA is deoxyribonucleic acid; it is a genetic material present in each and every living cell and…
Q: draw the hydrogen bonds for the following nucleic acid base pair: G and C
A: In nucleotides, nitrogenous bases are aromatic heterocyclic substances. Purines and pyrimidines are…
Q: Which generic class of reaction results in the phosphodiester bonds of nucleic acids, analogous to…
A: In nucleic acid, the nucleotides are connected to each other through the formation of a…
Q: Name the bases in the pentanucleotide with the sequence G-A-U-C-A. Does this come from RNA or DNA?…
A: The nucleic acids Deoxyribose sugar (DNA) and Ribose sugar (RNA) are nucleotides that are made up of…
Q: Describe and identify nucleic acid chains in DNA and RNA.
A: Our cell possesses only two types of genetic material that is DNA and RNA, which are involved in…
Q: How does the alpha-helix result from hydrogen bonding?
A: Alpha-helix : It is a common motif in the secondary structure of proteins and is a right hand-helix…
Q: What kind of repeating polynucleotide would yield a single polypeptide with a tetrapeptide repeating…
A: Polynucleotide is a sequence of nucleotides. Nucleotides consist of a sugar molecule, a phosphate…
Q: What are the three parts of a nucleotide
A: Nucleotides are the building blocks of nucleic acids, viz. Deoxyribose nucleic acid (DNA) and Ribose…
Q: Draw the structure of the first 3 nucleotides in the nucleic acid sequence attaaaggtt tataccttcc…
A: Introduction: A nucleotide consists of a nitrogen base, a pentose sugar, and a phosphate group.
Q: What kind of macromolecule is shown in the image?
A: Biochemistry deals with the study of the structure and functions of molecules involved in the living…
Q: Name the nitrogenous bases that are bonded
A: Given image shows nitrogen bases. Both of them are heterocyclic aromatic rings. One contains two…
Q: What is required to form a phosphodiester bond withanother nucleotide ?
A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…
Q: Two proteins with the same amino acid composition do not have the same primary structure. Explain…
A: Protein Proteins are the polymers of nitrogenous compounds called amino acids. Each amino acid…
Q: What is a nucleotide
A: Nucleotides are of 4 types based on nitrogen bases. The nitrogen bases in the DNA are adenine,…
Q: In the tertiary structure of a protein, which pair of amino acid side chains would be most likely to…
A: Introduction: Protein are the most bountiful natural particles of the living framework. They can be…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’
- The following strand of DNA is transcribed: 5'-GACCTCCGAATGC-3' Write the sequence of the resulting product from 5' to 3'. Only write the symbols for the bases; do not write "5'-" and "-3'" in your sequence.The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features – capitalization does not affect the nucleotide indicated. 5’…atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc…3’ a. Underneath that strand write the sequence of the strand of DNA it would be paired with in a doublestranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, U-uracil and C-cytosine and remember to label the 5’ and 3’ ends. b. Next, write the sequence of a possible mRNA transcript of the double stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5’ and 3’ ends. c. Using the genetic code, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein below the mRNA sequence in (b) and label the amino and carboxy terminals d. Suppose the bracketed, bold [a] were mutated to be a t. Write the new sequence of your mRNA transcript…Which type of nucleic acid is the following sequence, 5'GGGCCC 3' A. DNA B. RNA C. Both DNA and RNA D. Not enough information
- One strand of DNA has the base sequence as shown below. Complete the transcription and translation of this strand. Non template strand: 5' A T G T A T G C C A A T G C A 3’ What is the amino acids?The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated. 5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3' a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals d) Suppose the bracketed bold [a] were…The DNA nucleotide sequence that's complementary will base pair to a strand of DNA with the following sequence, 5' GTAATC 3' is? 5'GUAAUC3' 3'CATTAG5' 5'CATTAG3' 3'CAUUAG5' 3'GTAATC5'
- One strand of a DNA molecule contains the base sequence 5'-ACTTGCCA-3'. Write its complementary base sequence.Sequence of nucleotides in a DNA strand is CAT TAG CAT CAT GAC, what will be the base sequence in complementary strand of RNA? A. GUA AUC GUA GUA CUG B. GTA ATC GAT GTA CTA C. TAG ATG ATG GUA CUG D. GTA ATG GTA GAT CTAA strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA - 5' please note the direction of the strand and the sequence. Give the complimentary sequence of RNA, noting the direction of the sequence.
