Which types of chromosome mutations Q.change the position of DNA sequences in a single chromosome without changing the amount of genetic material?

Q: describe what is CNVCopy number variant?

A: The human genome consists of 6 billion chemical bases or nucleotides of DNA packed into two sets of…

Q: 20. Describe three types of DNA repair that can occur in the cell. Name the three types and briefly…

A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: In cancer like disease, what kind of mutations are more focussed? Single Nucleotide Polymorphism or…

A: Introduction  Cancer is well known disease now a day. In US, 1 in 2 women and 1 in 3 men develops…

Q: What Happens When Cellular Repair Mechanisms Meet Free Chromosome Ends?

A: Genetic variation is very important for evolution, but genetic stability is crucial for survival…

Q: how Inversions Reorganize the DNA Sequenceof a Chromosome?

A: Mutations are variations in codons caused by changes in nucleotides at or near the coding sequence.…

Q: does  Inversions alter the order , of geneson a chromosome

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: Explain why cell injury due to genetic causes are alarmingly increasing each year.?

A: Cell injury is damage in the cell that occurs due to some external and internal…

Q: Which types of chromosome mutations Q. move DNA from one chromosome to a nonhomologous chromosome?

A: A chromosome mutation is a mutation that affects a chromosome 's structure, leading to an anomaly…

Q: In which phase(s) of the cell cycle is the status of the DNA assessed, and if there are any…

A: The correct option for the above question is Both G1 and G2.

Q: What type of chromosomal rearrangement occurs o Breakage of two homologous chromosomes or sister…

A: A chromosomal rearrangement is a type of chromosome abnormality involving a change in the structure…

Q: Define inversions

A: The variations in the chromosome structure arises because of the following four processes :…

Q: Explain how chromosome deletions, inversions, and translocations cancause cancer.

A: Cancer is a disease which is caused by the uncontrolled growth of the cells, without regulation of…

Q: In Cystic Fibrosis: How is the gene/chromosome affected? How is the cell, tissue, and body systems…

A: Cystic fibrosis is an innate sickness that influences the lungs and stomach related framework. The…

Q: Why do deviations from the normal chromosome number of 46affect health?

A: Karyotype is a diagrammatic representation of arrangement of chromosomes. Humans have 46…

Q: Why is the Philadelphia chromosome important to understanding & treating some cancers, especially…

A: Philadelphia chromosome is only present in the blood cells that are affected because of the damaged…

Q: Explain how chromosome deletions, inversions, and translocations can cause cance

A: any change in the number or structure of the chromosome is termed as chromosome aberration, it is of…

Q: List the genetic disorders resulting from chromosome deletions:

A: The genetic disorders are caused due to absence or excess or abnormal arrangement of one or more…

Q: Disdis -how do RB and p53 negatively regulate the cell cycle in G1? describe the events that occur…

A: A series of events which takes place in a cell due to which it divides and forms two daughter cells…

Q: In terms of chromosome mutations, what are the significance of monosomy/trisomy, auto/allo…

A: MutationMutation is a sudden change that occurs in DNA or gene due to mistake during DNA is copied…

Q: Which types of chromosome mutations a. increase the amount of genetic material in a particular…

A: Hi! Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: What is the chromosome abnormality in cri du chat syndrome?

A: Cri-du-chat syndrome, commonly known as 5p- (5p minus) syndrome. Infants with this syndrome…

Q: Distinguish

A: Chromosomal abnormalities:-Almost every cell in our body contains 23 pairs of chromosomes, for a…

Q: Are genome and karyotype instabilities consequencesor causes of cancer?

A: Genome ad karyotype instabilities really leads to cancer.Lets have a detailed discussion: Genome…

Q: what is common repairs strategy to realign misaligned chromosomes?

A: DNA damage refers to the change un structure of DNA which can happen due to chemical changes, strand…

Q: (a) How does the duplication of individual genes occur? (b) individual that inherit a genetic…

A: Mutation in the DNA can change our genetic material that can causes changes in our phenotype as…

Q: How are genetic variants identified?

A:

Q: Explain Chromosome abnormalities  Deletions

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: Explain Loss of p53 function leads to genomic instability?

A: The TP53 gene provides instructions for making a protein called tumor protein p53 (p53). This…

Q: Once created, new combinations of genes will be acted upon by ________________________________

A: New combination of genes are formed either by mutation or by the recombination. New combination of…

Q: s the chromosomes are being replicated, what happened to the centrosome?

A: A centrosome is a structure present in the cell that participates in cell division. The centrosome…

Q: Show the difference between a chromosomal aberration and gene mutations using example/s.

A: Mutations basically refer to the random change in the DNA sequence that usually alters the phenotype…

Q: What are genomic variants?

A: The term variant is often used to refer to a specific region of the genome which differs between two…

Q: Why is the incidence of survivable genetic disorders involving deletions of parts of chromosomes so…

A: Deletion is a type of mutation in which a part of DNA molecule is not copied during DNA replication.…

Q: How

A: Introduction :- In the cell nucleus, the DNA double helix is tightly wrapped around nuclear…

Q: Which types of chromosome mutations Q.decrease the amount of genetic material in a particular…

A: Mutations are the alterations or the changes that occurs in the DNA. Mutagens are the agents that…

Q: Which types of chromosome mutations Q.increase the amount of genetic material in all chromosomes?

A: Mutations are the alterations or the changes that occurs in the DNA. Mutagens are the agents that…

Q: List the three basic categories of chromosome mutations and define each one.

A: Aneuploidy refers to a condition of an abnormal or unusual number of chromosomes. Normally each…

Q: What is the Philadelphia chromosome? How is this chromosome related to cancer? Identify how this…

A: A chromosome could be a dna (deoxyribonucleic acid) molecule with some  or all of the genetic…

Q: Which types of chromosome mutations Q. increase the amount of genetic material in a particular…

A: Mutations are any changes in the genetic material of the cell. Chromosomes contain the genetic…

Q: What the genetic disease talk about? What cause of the genetic disease?

A: Genetic disease means the disease that is caused by a mutation in the genome and these mutations are…

Q: "A deletion of a portion of a chromosome need not be very great before the effects become severe".…

A: The genetic material of a cell is a nucleic acid. Most of the organism has DNA as the genetic…

Q: When Replacement of the original gene occurs ?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: Do all genetic diseasesresult from alteration in thenumber of chromosomes ofthe cells?

A: Defined about all genetic diseases result from an alteration in the number of chromosomes of the…

Q: 1. Describe the cell cycle. Why do cells divide? Why are the resulting daughter cells from Mitosis…

A: The cell is the structural and functional unit of the body. The cells generally divide to form new…

Q: Describe the levels of organization in the DNA molecule when in the form of a visible chromosome.…

A: Nucleosome model is a scientific model which explain the organization of the DNA and the associated…

Q: What is mutation? Distinguish between neutral and silent mutations; germ-line and utations; trisomy…

A: Since there are multiple questions in this particular question, I will answer the first three…

Q: What are the similarities a chromosomal mutation and point mutation?

A: Chromosomal mutation is a numerical or structural change in a chromosome. It causes Klinefelter…

Q: What is mutation? Distinguish between (i) neutral and silent mutation (ii) germ line and somatic…

A: Mutations can sometimes be beneficial, when they result in traits that will benefit the organism.…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.