Why and how do the polymerase go backward from state 2 (post-translocation state) to state 1(pre-translocation state) during replication and transcription?
Q: What is allosteric regulation? Describe HOW allosteric regulation acts like an “on/off” switch for…
A: The cell signaling is the communication between cells that requires specific signaling molecules…
Q: A. Why are there multiple positive results in Blood Hemolysis test? B. In general what is/are the…
A: Introduction :- Hemolysis is the process by which red blood cells (erythrocytes) break down and…
Q: At what temperature and what pH do most human enzymes work best?
A: An enzyme is a type of protein that acts as a biological catalyst, meaning it speeds up chemical…
Q: What differences exist within keratinocytes of the superbasal epidermis between individuals of dark…
A: Introducion Skin is the most important organ of human body. Skin acts as a barrier in human body.…
Q: You are studying an archaeal organism. You are surprised to find that, actually it costs it two ATP…
A: The energy production in the form of ATP by the breakdown of complex carbohydrate such as glucose,…
Q: This woodlot experienced a fire in 1969. That suggests that this figure shows primary succession in…
A: Since 1969, at first the species of trees grew in numbers but after a certain point of time, two of…
Q: igure 5. This figure shows the number of individuals of three tree species (Blue Pine, Black Oak,…
A: Growth rate of population can be defined as how fast size of population changes over time. When the…
Q: 1. All of the following statements are true of active transport across membranes except: a. It has…
A: A photosystem is a complex of proteins and pigments that is involved in the light-dependent…
Q: Water contaminants fall into two general categories, chemical and biological. Describe each…
A: Water contamination refers to the presence of harmful substances or pollutants in water sources,…
Q: What happens in the presence of high cellular concentrations of tryptophan? a) tryptophan binds to…
A: Introduction:- Tryptophan is an essential amino acid, a component of proteins necessary for growth.…
Q: State and explain in detail the Mechanism of influenza virus types C and D
A: Influenza, commonly referred to as the flu, is a contagious viral illness that affects the…
Q: In a real study, scientists investigated the effectiveness of seven hand sanitizers. They found that…
A: LRV is an abbreviation for "Log Reduction Value," which is a measure of a disinfectant effectiveness…
Q: Give an example of the “epidemiological paradox.”
A: Introduction Epidemiology is the branch of medical science that deals with the study of the…
Q: you can create a bar graph or a line graph to represent the respiratory volumes and capacities…
A: Respiratoy volumes and capacities are shown in the graph above and we have to plot bar graphs for…
Q: could be used to determine human blood group type. Glycoproteins Lipoprotein Lipopolysaccharides…
A: Blood group refers to the classification of blood based on the presence or absence of certain…
Q: How are diatoms and dinoflagellates used in monitoring water quality? Cite two (2) examples.
A: Diatoms and dinoflagellates are dominating phytoplankton groups and are the most important prey…
Q: The amino acids in a normal polypeptide chain are proline, arginine, aspartic acid, lysine, and…
A: The DNA sequence of a gene is altered to generate a different result, which is known as a genetic…
Q: people incorrectly assume that tomatoes are a vegetable rather than a fruit. Which of the following…
A: Tomatoes are often confused with vegetables due to their appearance, which is similar to many…
Q: c) The extracellular matrix molecule specifically detected in the region of positive staining…
A: Introduction: The acellular stromal microenvironment of tissues is made up of an intricate network…
Q: Describe HOW/WHY phosphorylation and de-phosphorylation act like an “on/off” switch for the relay…
A: Phosphorylation is the process of adding a phosphate group to a molecule, typically a protein, by a…
Q: Describe at least 3 things scientists can look at to separate eukarya from bacteria and 3 things…
A: Scientists must distinguish between different types of creatures in order to better comprehend the…
Q: A. Match the letters with the correct leukocyte name, which are: basophil, eosinophil, neutrophil,…
A: Leukocytes, also known as white blood cells, are a type of blood cell that plays a crucial role in…
Q: Match the letters to their correct name A B C D E F A Spinal Cord C PNS O O O O D O O O O O O…
A: The brain and spinal cord and cranial nerves and spinal nerves make up the nervous system. *It is…
Q: What are some of the best foods to eat for digestive health?
A: Introduction Digestive health refers to the state of our gastrointestinal (GI) tract, which is…
Q: If a patient collects a 24 hour urine specimen with a volume of 1500 mL, and the patient's serum…
A: Urine creatinine levels can be used as an indicator of kidney function, and it is often measured…
Q: May the food web please be in circle format example below:
A: Food web is a ecological representation of different trophic levels in which one organisms forms the…
Q: If Bird J and Bird G compete for food, then over time their ranges must change for both species to…
A: When two or more species try to utilize same resource, then a competitive interaction can be seen…
Q: Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh…
A: Drosophila Melanogaster: Drosophila is a genus of small, fruit-eating flies commonly known as fruit…
Q: there is nucleotide selectivity during replication, why do polymerase choose a wrong nucletide and…
A: A nucleotide is the basic building block of nucleic acids, such as DNA and RNA. It is composed of…
Q: Large international variations in rates of communicable diseases, undernutrition, and maternal and…
A: Introduction : Pathogens are microscopic organisms that cause diseases in humans and kther…
Q: How does huckleberries impacts society, specifically indigenous peoples
A: Huckleberries are a type of berry that grows on small shrubs in North America. They are related to…
Q: The operator of the lac operon is upstream of the gene that codes for enzymes. What does upstream…
A: Lac operon: The lac operon is a genetic regulatory system found in bacteria that controls the…
Q: Use the following figure to determine the amino acids that correspond to the mRNA sequence: 5' CAC…
A: The mRNA codons can be read from the figure by finding the first base of the codon on the left side…
Q: An accumulation in mutations in genes involved in _______ and _______ may lead to cancer. cell…
A: Cancer is a complicated illness caused by the accumulation of mutations in key genes. Understanding…
Q: Provide images for the discussed solution about the types c and d mechanisms.
A: Type C and type D influenza viruses cause viral influenza in humans and cattles respectively.…
Q: Only Handwritten answer needed Using multinominal coefficients: How many DNA strings of length 13…
A: Introduction Finding the placement of the nucleotides (adenine, guanine, cytosine, and thymine) in…
Q: Give correct typing answer with explanation and conclusion When ONLY glucose and NO LACTOSE is…
A: lac-operon is an inducible operon which expresses only in the presence of an inducer. Inducer is a…
Q: Put the following muscles in order from medial to lateral. (a) 1st (most medial) (b) 2nd (c) 3rd (d)…
A: A muscle is a type of soft tissue found in the body of animals, including humans, that is primarily…
Q: What do we call all the other cells (you can see their nuclei, the small dark dots, in the image…
A: Neurons: Information from one part of the bodyto another is sent via neurons. They communicate…
Q: What exactly does it mean to have "physical security" when it comes to the protection of one's body?
A: Physical security is a critical aspect of personal safety and involves a range of measures to…
Q: Which of the following statements is true? a. Case reports and case series are not useful as…
A: Case Report: A case report is a detailed description of an individual patient's clinical history,…
Q: what happens visually when a tumor damages the midline fibers that cross at the optic chiasm
A: The structures that transmit visual information from the retina to the brain make up the visual…
Q: r The sequence change shown below is the result of what kind of mutation? Coding DNA sequence before…
A: Mutation: Mutation refers to a process that results in a permanent change in the DNA sequence of an…
Q: The dot plot above shows cells that have been characterised by forward and side scatter. Forward…
A: Fluorescent dyes can be used to detect and monitor pollutants in the environment. Fluorescent dyes,…
Q: What is the process of glycolysis and its importance in energy production?
A: The metabolic process known as glycolysis releases energy in the form of ATP and NADH after turning…
Q: List the defense mechanisms of the GI tract (at least 3), including cells that fight bacteria to…
A: Introduction Defense mechanisms are psychological strategies that individuals use to cope with…
Q: Figure 4. This map shows the range of five different bird species in North America based on data…
A: Dispersal is the movement of individuals or propagules (such as seeds, spores, or larvae) away from…
Q: Describe the physical, chemical and biological limitations for those available microhabitats. Relate…
A: Ecology is the scientific study of the relationships between living organisms and their environment.…
Q: Create a schemetic diagram of the experimental procedures down below (Also, attached below is a…
A: Chloroplast is the cell organelle that is found in plant cells and responsible for performing…
Why and how do the polymerase go backward from state 2 (post-translocation state) to state 1(pre-translocation state) during replication and transcription?
Step by step
Solved in 3 steps
- Andy and Anne do not have polydactyl. Is it possible for them to have a child with polydactyl? Explain.Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'Please give numeric value
- this is for primer 2 not primer 1Draw the following trinucleotide: pGAUYou have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ 1. For the second, third, fourth, and fifth codons, write all possible anticodon sequences (left-to-right, 5’-3’), including anticodons with wobble and inosine. 2. Write the amino acid sequence of the wild-type allele (three letter or single-letter amino acid abbreviation ok). 3. For each of the following mutations: A. State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change that occurs for the missense, nonsense, and silent mutations (ex. GAA GAT). C. For frameshift mutations, write out the entire mutant sequence with each codon clearly indicated (if the frameshift creates a new stop codon, end the sequence at the new stop). D. Write the amino acid sequence of the mutants. Mutant 1: transition at nucleotide 23 Mutant 2: TG transversion at nucleotide 29 Mutant 3: an insertion of “A” after nucleotide 14…
- Which one of these is correct ? And why are the rest incorrect?For the following sequence design the forward and reverse primer... explain and justify your answer. Full sequence would be: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg…For the following sequence please design an 18 base pair REVERSE primer. ATG TCA AAA GCT GTC GGT ATT GAT TTA GGT ACA ACA TAC TCG TGT GTT GCT CAC TTT GCT TAA