Why are transfer RNAs important in translation? Dogenes for tRNAs have promoters, and are tRNAstranslated? What are aminoacyl-tRNA synthetases, whatare their substrates, and what do they do?

Q: Yet another class of suppressor mutations not described in the chapter are mutations in tRNA…

A: Frameshift mutations result from the "insertion or deletion" of nucleotides within the coding…

Q: What are aminoacyl-tRNA synthetases?

A: A protein or polypeptide sequence is biosynthesized during translation inside a live cell. The…

Q: The difference between prokaryotic and eukaryotic protein initiation is that eukaryotes' initiator…

A: Translation is the process of Synthesis of proteins from amino acids by peptide bond formation. It…

Q: What function do the 5' cap and the poly-A tail serve on a eukaryotic mRNA?

A: DNA is a long polymer of deoxyribonucleotides. It is an acidic substance present in the nucleus,…

Q: Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the…

A: During Protein synthesis or translation  that occurs in ribosomes, messenger RNA code for an amino…

Q: In the splicing of group I introns shown, does the 5′ end of the intron have a phosphate group?…

A: Introns are the inert elements in the DNA. They are otherwise said to be non coding regions of DNA…

Q: How does C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA…

A: RNA polymerase II is a multiprotein complex that transcribes DNA into precursors of mRNA and…

Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5

A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…

Q: Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are)…

A: A codon refers to a specific sequence of deoxy ribonucleotide (DNA) or ribonucleic acid (RNA), which…

Q: Describe translation. What is the function of the aminoacyl-tRNA synthase?

A: Protein synthesis: It is a process that involve peptide bond formation between the amino acids by…

Q: How does it improve the efficiency of protein synthesis to have several binding sites for tRNA close…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: Transfer RNA molecules are quite large, given that the anticodon consists of only three nucleotides.…

A: Proteins within the human body are made up of a small chain of building blocks, which are termed…

Q: How and when does formylmethionine become attached to the initiator tRNA in bacteria?

A: Bacterial cell is composed of three types of RNA: first type is mRNA, which codes for amino acid to…

Q: Each transfer RNA requires at least four specific recognition sitesthat must be inherent in its…

A: Ribonucleic acid is a polymeric molecule essential in various biological roles in coding, decoding,…

Q: In an amino acyl-tRNA, the amino acid is attached to the tRNA through a(n) acid and the CCA sequence…

A: The translation is the process by which proteins are synthesized from mRNA through a sequence of…

Q: What are the three functional parts of the tRNA and what is their importance to translation?

A: Transfer RNA or tRNA generally contains 76-90 nucleotides and acts as a physical link in between…

Q: Although aminoacyl-tRNA synthetases make few errors, occasionally an error does occur. How can these…

A: Each aminoacyl-tRNA synthetase is highly specific for a given amino acid. It will incorporate the…

Q: At least one nonsense suppressing tRNA is knownthat can suppress more than one type of…

A: tRNA is a transfer ribonucleic acid. It is a type of RNA which decodes the messenger RNA and form a…

Q: What naturally found amino acyl tRNA synthetase can be used to attach 2-aminobutyric acid to a tRNA?…

A: Higher living beings vary in their ability to synthesize the 20 common amino acids. Most bacteria…

Q: Explain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or…

A: The attachment of the amino acid to the cognate tRNA is caused by the aminoacyl-tRNA synthetase.…

Q: The wobble pairing rule states that a 'U' in teh anticodon wobble position can pair with 'A' or 'G',…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: What makes the bacterial and eukaryotic initiator tRNAs different from other RNAs, and how do these…

A: Transfer ribonucleic acid is a type of RNA molecule that helps decode a messenger RNA sequence into…

Q: Why is it essential that tRNA binds to both amino acids & mRNA codon during protein synthesis?

A: Protein synthesis involves translation of mRNA into a protein that requires three complex stages,…

Q: The amino acid sequence for a short peptide is Tyr-Leu-Thr-Ala. What are the possible base sequences…

A: Gene expression is the process by which information from a gene is used for synthesizing of a…

Q: How do prokaryotic cells overcome the problem of a stalled ribosome on an mRNA that has no…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: In a typical mammalian cell, about 80% of all of the RNA consists of ribosomal RNA, and another…

A: Ribonucleic acid or RNA is a type of nucleic acid present mainly in the cytoplasm of the cell. It is…

Q: What steps are required to form a charged tRNA?

A: Transcription: It is processed to convert DNA into RNA. It is part of the central dogma. It is…

Q: If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu…

A: Introduction  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: In prokaryotes, _________bind to a sequence called theShine-Dalgarno box adjacent to the AUG…

A: Shine Dalgarno box sequence is found on mRNA 8 bases upstream of the start codon. The start codon is…

Q: What is RNA splicing (make sure to include any relevant terms)? What structure is used to splice…

A: RNA Ribonucleic acid or RNA is a long polymer like DNA molecule. The RNA has many purpose like it…

Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…

A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…

Q: What two different things bind to the two different ends of a tRNA molecule?

A:

Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…

A: The central dogma of life involves three major steps that include: DNA replication: This is the…

Q: The 3 sites that bind tRNAs on a ribosome are on the A, P and E sites. How many sites can tRNA(s) be…

A: Translation is the formation of protein from mRNA. It occurs in cytoplasm of cell.

Q: To carry out its role, each transfer RNA requires at least four specific recognition sites that must…

A: Transfer RNA (tRNA) is formerly known as soluble RNA. They are adapter molecule that serves as a…

Q: How exactly do I identify a tRNA with respect to mRNA? Ie: What exactly does the tRNA do and how is…

A: Transfer RNA or tRNA is a member of a nucleic acid family called ribonucleic acids. RNA molecules…

Q: some eukaryotic mRNAs have internal ribosome binding sites, where ribosomes can bind without first…

A: Alternative splicing is a regulated process in which a single gene coding for multiple proteins…

Q: What features of tRNA structure are involved in recognition and amino acylation by an aaRS?

A: Transfer RNA also called amino acid acceptor RNA, adaptor RNA, or soluble RNA is the RNA that…

Q: Bacterial messenger RNAs usually contain many AUG codons. How does the ribosome identify the AUG…

A: AUG codon codes for methionine. It is the initiation codon that helps in initiating the translation…

Q: . What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61…

A: The three consecutive nucleotides on messenger ribonucleic acid from codon. The codon sequence…

Q: Why does a bacterial mRNA bind specifically to the small ribosomal subunit?

A: The ribosome is a very complex structure, whose machinery is broadly divided into larger and smaller…

Q: How is the initiation codon identified by the ribosomes during translation in prokaryotes and…

A: Prokaryotic Translation: The tRNA binds to the mRNA close to the 5' cap and begins to scan the…

Q: What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to…

A: The soluble ribonucleic acid (tRNA) plays a significant function in protein synthesis.

Q: Position on the small and large ribosomal subunits which the peptidyl-tRNA occupies prior to peptide…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is transcribed to…

Q: Prokaryotic mRNAs have a RBS (Ribosomal binding site). How they use RBS for translational machinery?…

A: Translation is synthesis of protein from the m-Rna and this occurs in the cytoplasm as all the…

Q: An RNA sequece includes 15 codons. How amny animo acids does this sequence encode?

A: The central dogma was given to depict the flow of genetic information. It includes various…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.