Answered: Why do you need to take samples from…

Science

Biology

Why do you need to take samples from the bloody or mucoid portion of the entire stool?

Basic Clinical Laboratory Techniques 6E

6th Edition

ISBN:9781133893943

Author:ESTRIDGE

Publisher:ESTRIDGE

Chapter7: Basic Clinical Microbiology

Section7.2: Bacteriology Specimen Collection And Processing

Problem 2RQ

See similar textbooks

Related questions

Q: Exercise 2. Complete the table with producing plant, Family, CHD English/Latin names. Producing…

A: Different plants may have similar physical appearances, and misidentification or substitution can…

Q: Know about the different staining techniques (simple, direct, negative, and differential), what is…

A: Staining techniques can provide valuable information about the morphology, structure, and…

Q: transcript the pre-mrna code, ACCUACGCGCCACACGUUCUCUACUAUCCCC, into mature mrna

A: Nucleic acids are "proteins essential to the structure and operation of all living cells. Nucleic…

Q: . How does uncoupling of electron transport and ATP synthesis affect the activity of ATP synthase,…

A: Electron Transport Chain uses electrons from an electron carrier to create a chemical gradient. It…

Q: Not a side effect of Ephidrine a. Seizures. b. Stroke. c. Increase in psychiactric symptoms. d.…

A: Ephedrine is a CNS stimulant that's frequently used to guard against low blood pressure during…

Q: Question 5. Which of the following statements regarding G-protein coupled receptors (GPCRs) is true?…

A: GPCR stands for G-protein coupled receptor. It is a large family of cell surface receptors that are…

Q: What is the incidence, prevalence, and mortality rate with chickenpox?

A: Varicella, also known as chickenpox, is a very contagious viral infection. The result is an itchy…

Q: Concept Map | Photosynthesis (~10 min) Help Last edit was seconds ago Background Layout Theme 1 1 1…

A: Introduction :- Photosynthesis is the process by which plants, algae, and some bacteria convert…

Q: hapter 3 Cardiorespiratory Endurance: Assessment and Prescription The following are the videos you…

A: Atp is stored in the muscles, they are available readily for producing movement . In any case,…

Q: Which of the following is used by plants to reduce heat input in a warm environment? Group of answer…

A: Warm environment means the temperature of the outside environment is high. This causes rate of…

Q: Casein, a protein in milk, has a molecular formula C38H57O9N9. Determine the total BOD, carbonaceous…

A: Microorganisms are critical to the BOD test because they are the primary agents responsible for the…

Q: Choose and discuss one genomic comparison that has been analyzed and the information that it…

A: Introduction :- Genomics is the study of an organism's entire genome, which is the complete set of…

Q: Some classmates are discussing arguments in favor and against eating meat. A classmate makes the…

A: Introduction A species is a basic unit of biological classification that refers to a group of…

Q: What is the role of the hypothalamus in the regulation of body temperature?

A: Pathophysiology studies functional changes in the body caused by an accident, ailment, or illness.…

Q: Provide detailed blood cell diagram of how microsytic is developed. Provide detailed blood cell…

A: Small, frequently hypochromic red blood cells are considered a sign of microcytic anemia, which is…

Q: Approximately 1% of the magpies (Pica pica) in a hypothetical populations are albino. Assume that…

A: (a) By using the Hardy Weinberg equation ee can calculate the frequency of albino allele. p² + 2pq…

Q: Differentiate horizontal and vertical gene transfer. Compare the mechanisms of genetic recombination…

A: Bacterial genomics is the study of the genetic material of bacteria, including their DNA sequences…

Q: RNSG 1301 Pharmacology 1. Describe the side effects, labs, and organs affected for a patient on…

A: Introduction :- Cephalosporins are a class of antibiotics that are commonly used to treat bacterial…

Q: The worldwide cattle industry is one of the significant contributors of greenhouse gasses. Several…

A: After Jon Vein applied for and was granted a patent to create synthetic or in-vitro meat in the…

Q: What are the main differences between inductive and deductive reasoning in the scientific method?…

A: This response provides a clear and concise explanation of the differences between inductive and…

Q: GMOs are highly controversial. Are GMOs dangerous? Should GMOs be labeled as such? Why, or why not?…

A: Genetically modified Organisms (GMO): GMOs, or genetically modified organisms, are organisms whose…

Q: Melting temperature (Tm) of 500 bases long DNA is defined as the temperature at which: a. All DNA…

A: Nucleic acids are "proteins that are essential to the structure and operation of all living cells.…

Q: Give the function of rhizoids. Is the individual germinating from the zygospore haploid or diploid?…

A: Any members of the eukaryotic organism family, which also contains the more well-known mushrooms and…

Q: TASK 2. Carry out a comparative microscopic analysis of the water-pepper herb and common knotgrass…

A: Intriduction:- Water pepper is an annual herb with an erect stem growing to a height of 20 to 60 cm.…

Q: QUESTION 6 Which of the following is NOT a type of blood pressure regulation? O neural controls…

A: Controlling blood pressure is crucial for preventing these health problems and maintaining good…

Q: Create a 3 generation pedigree chart for the given: Blood Type B child, Blood Type B Mother and…

A: Pedigree Chart A pedigree chart is a chart that shows the genetic relationships between members of…

Q: DNA synthesis

A: DNA synthesis is the process of creating deoxyribonucleic acid (DNA) molecules, either naturally or…

Q: A 25-year-old female presented to her 28 week antenatal appointment with the complaint of lethargy.…

A: Identifying the underlying cause of anemia and providing appropriate treatment is crucial to improve…

Q: following questions. Your answers should contain only nucleotides GCATTATCT for DNA, GCAUUAUCU for…

A: Nucleotides are the building blocks of nucleic acids, including DNA and RNA. They are composed of…

Q: A phenotypically normal boy has 45 chromosomes, but his sister, who has Down syndrome, has 46.…

A: Genetic information is stored in chromosomes, which are long, coiled strands of DNA. Most human…

Q: Which of the following would allow a plant to tolerate a cold environment? Group of answer choices…

A: Introduction Plants in cold environments may also have different growth strategies, such as…

Q: Select All That Apply (SATA) question. What do male Drosophila (fruit flies) have that females do…

A: Fly species belonging to the taxonomic order Diptera and family Drosophilidae include Drosophila…

Q: Using the antibody panel provided, answer the following questions Are there antibodies that cannot…

A: This question focuses on the results of an antibody panel for a patient and asks about the…

Q: 2.2. Discuss soft tissue injuries/wounds 3. The different kinds of open wound 4. Discuss burns 2.

A: 2. Soft tissues support and connect other tissues and organs in the body.. For example muscles, fat,…

Q: Contrast the movement of chyme in the small intestine vs. a bolus in the esophagus.

A: Introduction :- Chyme is a thick, semifluid mixture of partially digested food and gastric juice…

Q: Explain Avery-MacLeod-McCarty experiment (the 1940's) with capsule forming bacteria (smooth) and…

A: Bacteria are single-celled microorganisms found in all environments on Earth, including soil, water,…

Q: la. How many different proteins are in the protein ladder? 1b. Ladder and antibody samples are…

A: SDS-PAGE It refers to the Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis. It is a…

Q: What unique health disparities does the ealdery population face and why is it important to address…

A: The elderly population faces unique health disparities related to aging and the cumulative effects…

Q: 3. Let us consider a relative of the platypus, the eastern long beaked echidna: Zaglossus bartoni.…

A: hypothesis is a proposed explanation or prediction for a phenomenon or observed event, which is…

Q: When water goes below 0OC, it: Group of answer choices A. vaporizes and becomes unavailable to…

A: Introduction Water is a vital component for life, and all living organisms rely on it for their…

Q: 100 100 5) Use the following phylogeny to answer the questions below. The numbers on the branches…

A: Based on this phylogeny, 6 clades are present within the ingroup of in which pampus fox belongs to.

Q: The reaction mechanism of alpha-amylase going through a Nelson Somagyi Assay. (please draw the…

A: The fact that enzymes are very selective and can only catalyze certain reactions contributes to the…

Q: For individual 1, telomeric mode value is 9.49 Kb. This means that this indivdual... a. All…

A: Telomeres are repetitive DNA sequences located at the ends of chromosomes that protect them from…

Q: 3. In humans, brown eye colour (B), is dominant over blue eye colour (b). a. What are the phenotypes…

A: Alleles are the alternative form of a gene that are located on the same locus of the homologous…

Q: Viruses are living or not living - that is the question!”

A: Microbes are the organisms that cannot be seen as such through naked eyes but require microscope for…

Q: Fill out the 3 generation pedigree chart below wherein the third generation male has hanging…

A: Introduction: Pedigree charts are family trees that show the members of a family who have been…

Q: • • • • • What is aseptic technique? What procedures in general (i.e. wash hands, disinfect work…

A: Introduction Sterilization is the process of eliminating all forms of microbial life, including…

Q: 250 uL of 1M azide was added to a 25 mL yeast solution. What was the concentration of azide in the…

A: Azide is a strong inhibitor of yeast mitochondrial respiration. It obstructs the electron transport…

Q: 2 How can the proteolytic, peptolytic and saccharolytic properties of bacteria be detected? What is…

A: Bacteria are unicellular microorganisms that lack a nucleus and other membrane-bound organelles.…

Q: Outer enamel epithelial (OEE) cells of the enamel organ serve which function?

A: During embryonic development, the enamel organ develops within the tooth. It is in charge of…

Question

Why do you need to take samples from the bloody or mucoid portion of the entire stool?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Why is there need to use Normal Saline Solution? What is the purpose of applying lugol’s iodine? Is there a need to use NSS in watery stool? Why or why not?
Why do you think it is important to refrigerate a urine sample if an analysis cannot be performed immediately after collecting it?
What are the clinical significance of red, black, and gray colored stool specimens?
The nurse who is caring for a new-born diagnosed with cystic fibroses has to assess the new-born for feeding and stool pattern. Explain why?
why are urine culture described as semiquantitative?
Two men have observed blood in their stool. One states that the blood is bright red. The other claims his stool is black. Discuss the causes for the differing symptoms.
Ms. Tan came to the laboratory for blood tests because her physician suspected renal disease. The tests ordered were serum BUN, creatine, and electrolytes. The blood specimen was obtained and processed. When the laboratory technician received the serum to perform the tests, he noticed that the seruum had a reddish tinge. Was there a problem with the serum sample? If so, what? What conditions could cause this to happen to a serum specimen?
What do hemolysis and crenation help explain?
Why is it unsafe for a fecal transplant recipient to receive fecesfrom an unscreened donor?
What are the factors to consider when handling a stool sample? Also, in 6-7 sentences, discuss the techniques used in microscopic examination of stool.
Based on these blood agar results, can you identify what type of hemolysis are occurring in these tests? Gamma, beta, or alpha? Not gamma, not beta, not alpha?