Why is it important that Telomerase synthesizes the repeat DNA in the presence of the shelterin proteins?

Q: A beneficial dominant mutation is expected to take fewer generations to reach high frequency than a…

A: There are few important points: A population genetics is the study of changes in the frequencies of…

Q: According to the recent malaria report of the Department of Health, Disease and Prevention Bureau…

A: The malarial parasite passes its life cycle I'm two different host's. The man is the intermediate…

Q: 1. What are advantages of nanotechnology in medicine and agriculture?

A: Introduction Nanotechnology:- It is the manipulation of materials on an molecular or atomic scale…

Q: 4. Applying: Use your knowledge of molecular and cellular biology to explain how the following…

A: SARS COV 2 or corona virus has created havoc by causing  pandemic recently and is still showing its…

Q: Similar genes in two separate lineages that are the result of a "lineage splitting event" A at some…

A: Species is defined as the group of individuals that can mate together.

Q: egmentation O Can be fused into specialized functional regions Is seen in insects, worms, and their…

A: The sequence repetition of similar organs, tissues, cell types on different body segments placed on…

Q: SSBS are: A single-stranded bodies called Okazaki fragments. B substrates for DNA ligases. ©…

A: The biological information flows through genes. DNA is the main genetic material of most of living…

Q: Question 1 In E. coli, the leading strand is synthesized discontinuously while the lagging strand is…

A: Replication of DNA It is the process through which a double-stranded DNA molecule is copied to form…

Q: Which of the following is/are the contents of the dorsal body cavity? A. heart and lungs B. brain…

A: Introduction - The cranial cavity, which houses the brain, and the spinal cavity, which houses the…

Q: Question 52 All of the following describe the general mechanism of DNA synthesis EXCEPT: A synthesis…

A: DNA replication is the important step to protein synthesis. At the nucleoplasm of cell DNA…

Q: Write True if the statement is correct and if it is False, change the underlined word or group of…

A: Introduction Phylogeny is the evolutionary history of a kind of organism, species or group, and…

Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…

A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…

Q: Describe how a product generated from glycolysis can be used for ATP production by the electron…

A: * Glycolysis is a metabolic pathway it  converts glucose into pyruvic acid and in this process free…

Q: Select all that apply about 02 and CO2. O Both are nonpolar molecules. Both can diffuse passively…

A: 1) Both O2 and CO2 are the non polar , uncharged molecules which passes through the membrane by…

Q: 31. Which of the following mechanisms is involved in increasing the sensitivity of a synapse…

A: Signal transduction pathways translate signals received at the cell's surface into cellular…

Q: A patient has just been brought into the Accident and Emergency (A&E) department of the local…

A: The stock solutions can be diluted to achieve the desired concentration. The calculations are based…

Q: Question 28 Intrinsic RNA chain termination is determined by specific sequences in the DNA called…

A: Dna super coils: DNA supercoiling is important for DNA packaging within all cells. Termination…

Q: Question 29 Expression of genes independently of regulation is termed: A constitutive expression. (B…

A: Ans 29  - the correct answer of the above question is B) AUTOREGULATION. Expression of genes…

Q: Your uncle has tried every diet under the sun, yet he is still a very large man. He probably has…

A: When a person eats excess food and is not put into use then this food turns into fat reserve which…

Q: What is the World Health Organization recommendation for the prophylaxis of rheumatic fever after a…

A: Rheumatic fever:A illness that can develop as a result of strep throat or scarlet fever that has…

Q: Which of the following is the most accurate statement regarding the problem with using life…

A: Option 3 Life expectancy give you average of country but significant differences within groups of…

Q: Intravenous solutions (IV Fluids) must be prepared so that they are isotonic to red blood cells. A…

A: Isotonic solution has same solutes as found in red blood cells. The red blood cell has 0.9% salt…

Q: need a good answer.with explanation.Thanks 1- Which of the following species appeared earliest in…

A: 1- Which of the following species appeared earliest in the fossil record? Choices ( Homo…

Q: Can two normal individuals of the same species with sexual reproduction have identical genomes and…

A: Introduction - Sexual reproduction is a type of reproduction that comprises a complicated life cycle…

Q: which type of transmembrane protein binds to insulin and opens a transport proteins allowing glucose…

A: Insulin is an peptide hormone secreted by the beta cells of the pancreas acting through a receptor…

Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…

A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…

Q: 1. Why has the hoatzin earned the nickname, "stinkbird? 2. Hoatzin chicks have unusual features…

A: As per Bartleby guidelines experts area allowed to answer only 3 sub-parts for given question.…

Q: By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 =…

A: Answer :- For the first question, the restriction site for the enzyme Sau3a is composed of four…

Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. Secreted ECM…

A: Proteoglycans are mucoproteins that are formed of glycosaminoglycans that are covalently attached to…

Q: The mechanism of activation of eukaryotic genes involves addition and removal of phosphate residues…

A: The eukaryotic system has a general trend of activating anything by phosphorylation and vice versa.…

Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…

A: * Okazaki fragment are short sequences of DNA nucleotides. * They are of approximately 150 to 200…

Q: Why do r-selected species tends to be successful in a pioneer community? Why? (answer in minimum of…

A: Depending on the nature of the life history and patterns of growth, reproduction the species are…

Q: Narcolepsy is thought to occur from dysfunction of neurons located in the hypothalamus hippocampus…

A: Introduction - Narcolepsy is a persistent sleep condition marked by excessive daytime sleepiness and…

Q: Question 2 DNA replication requires the participation of at least 8 nucleoside triphosphates. (A…

A: DNA replication is a process where two copies of daughter DNA are made from one parental DNA.…

Q: You are checking a calculation that a foundation pharmacy student has performed. The question asks…

A: 120 suppositories weighing 1 gram are to be made, containing 300mg Zinc Oxide. The displacement…

Q: Q4.1. The image below shows a neuron's response to a medium-intensity stimulus. Which of the options…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Use what you know about inflammation to explain how periodontal organisms might be responsible for…

A: Suppose that bacterial plaque builds up in patient's oral cavity (on the teeth). This leads to…

Q: Describe the age structures in rapidly growing countries, slowly growing countries, and countries…

A: Introduction: In population dynamics, age structure considered being a crucial factor because it is…

Q: Define a ketogenic diet and give an example of a ketogenic meal. Explain why ketone supplements…

A: Introduction Cancer is a disease that develops when cells divide uncontrolled and spread throughout…

Q: explain what is similar and what is different from the bacteriophages of covid-19

A: Bacteriophages or phages are the viruses that infect and kill bacteria. Bacteriophages consist of a…

Q: escribe extensions of Mendelian Analysis

A: In an over view, Mendel's laws have been extended to include Multiple Alleles Incomplete Dominance…

Q: 3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your…

A: KCN/Potassium cyanide broth is mainly used to differentiate the members of Enterobacteriaceae family…

Q: The critical stages when irrigation is needed are during the flowering or early fruiting stage and…

A: Introduction Irrigation is the process of applying water to the crops artificially through various…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: Microorganism A was exposed to different constant temperatures to get the specific D- values.…

A: The Z-VALUE is the boom or decrease in temperature required to lessen or increase the decimal…

Q: Select the correct answer. Marcus is admitted to the hospital for a bone marrow stem cell transplant…

A: The cell division is the production of new daughter cells from the old mother cells. Usually in…

Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. GPI-linked…

A: Proteoglycans are mucoproteins which are formed by glycosaminoglycans that are covalently attached…

Q: Organisms that produce offspring that always look like the parents are said to be: O Purebred/Pure…

A: Organisms that produce offsprings that always look like the parents are said to be.

Q: Assume tu inoculated 100 facultative anaerobic cells unto nutrient agar and incubated the plate…

A: Microorganisms are categorized based on the requirement of oxygen in the media. Obligate aerobes…

Q: Biology QUESTION 1. compared the seawater (SW) acclimation response of three salmonid species. All…

A: Fish are aquatic animals that live in the sea, rivers, lakes, and oceans. Individuals increasingly…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.