Q: Hardy–Weinberg equilibrium
A: Gene: Gene is defined as an inherited factor which determines the characteristic feature. Allele:…
Q: when you eat food that contains carbohydrates you break down the carbohydrates into a…
A: Carbohydrates is a biomolecule which is consisting of hydrogen, oxygen and carbon. It is one of the…
Q: 2 3 4
A: When when a growth of particular Organism or population is recorded and represented in graphical…
Q: Is food going down the esophagus an involuntary action?
A: Esophagus It refers to the muscular tube which connects the throat with the stomach. It is about 8…
Q: list and describe the ways meiosis increases variability; be able to discuss importance of genetic…
A: Meiosis is a type of cell division that results in four daughter cells each with half the number of…
Q: How many rabies cases are there in the world today
A: Rabies is a virus-based illness that is lethal yet curable. If they are bit or clawed by a rabid…
Q: Question 1 of 10 What enables a whale to move its fins in the ocean? A. Energy from the rotation of…
A: C. Energy directly from its food, enables a whale to move its fins in the ocean. The energy to…
Q: Name the parts that carry out the excretory process in fresh water protozoa and mammals
A: The excretory system is a network of organs and tubes that work together to rid the body of waste…
Q: 2. Carbohydrates are needed for different cellular processes/components. Which statement is NOT an…
A:
Q: Compare the number and type of chambers found in fish, toad and human hearts – how do they differ?…
A: Humans and the majority of other animals depend on their hearts to stay alive. Examining the…
Q: Briefly describe the components of the four major types of lipoproteins and explain the function of…
A: Introduction: The chemical processes that keep the body of a live organism sustainable are referred…
Q: Lymphatic System Histology, Structures, & Functions
A: Like circulatory system, the lymphatic system, or lymphoid system, is an organ system in vertebrates…
Q: Q1. Determine if the event occurs during mitosis or during meiosis. Copy and paste, mitosis or…
A: The cell division is the process of making two or more daughter cells from a parent cell. There are…
Q: What did the miller-Urey experiment demonstrate
A: Introduction Miller-Urey experiment:- It is the experiment that suggests that organic molecules…
Q: What structural and biochemical changes does the spermatid undergo during permiogenesis? How do…
A: spermiogenesis is the final stage of spermatogenesis that involves maturation of spermatids into…
Q: Make a brief summary of each of the stages of bacterial growth.
A: Bacterial growth occurs orderly in which the cellular constituents as well as the number of…
Q: Explain how the following factors affect the blood velocity and volume flow rate as well as…
A: The blood vessels are tubular in structure that helps the blood to flow throughout the body. The…
Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…
A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…
Q: In Anopheline mosquitoes an inversion associated with resistance to desiccation involves the…
A: Inversion Inversion refers to a rearrangement that involves two breaks within a single chromosome…
Q: can u pls explain the photo? (direction: cut and paste or illustrate images of the given ecological…
A: Ecological communities are made up of all the species living together in an area. In community…
Q: What are the four macromolecules
A: Molecule is produced as a result of combination of different atoms. Macromolecules are kind of…
Q: Mortality, natality, immigration, emigration. Per capita growth rate Growth rate Population density…
A: Introduction : A population is any group or species of organisms that may interbreed, exist in a…
Q: Describe the chain of events that connect the release of CFCs from discarded refrigerators to…
A: Introduction : CFC's are the Chlorofluorocarbons.They are the chemical substances that are held…
Q: Which of the following topics would fall under the purview of biology? (mark all that apply)…
A: Biology is one of the oldest branches of science. Any piece of knowledge related to the living world…
Q: Based on this information, answer the following questions. a) What is the possible microbial…
A: Inflammation of the cerebrospinal fluid (CSF) and meninges surrounding the brain and spinal cord is…
Q: .. Describe how mutations are linked to DNA polymorphism
A: Note: Sorry, Please note that as per our company's honor code, we are not allowed to cite external…
Q: What leads to teenage pregnancy
A: Introduction: Adolescent pregnancy is a worldwide problem, although it most frequently affects…
Q: Answer the following questions related to bias in screening studies. A- Explain in your own word,…
A: Lead time:- it is the time duration between the detection of a disease via screening or any…
Q: 4. Label the diagrams of cells with the following terms: diffusion, active transport, osmosis,…
A: Introduction As the cell is bounded by the membranous structure which does not allow the molecules…
Q: Hobb's method
A:
Q: The increase use of fossil fuels increases the Select one: O a. rate of photosynthesis of marine and…
A: Fossil fuels are the reserved fuels buried in the deep earth crust. The supply of fossil fuels is…
Q: What promotes coexistence between competing species? Predation, disturbance, and metapopulation…
A: Species It refers to the basic unit of diversity for classifying organisms. It is the group of…
Q: Visitors to Plimouth Plantation are often surprised by the low ceilings and narrow door frames of…
A: A population's heritable characteristics change over successive generations, resulting in evolution.…
Q: 11:04 patients would recover more quickly than those who did not take the antibiotic. The…
A: Introduction Antibiotics, commonly referred to as antibiotics, are drugs that stop or inhibit the…
Q: Explain the following areas about (kidney stone removal device) 1. What are the ingredients the…
A: The kidneys are reddish-brown bean-shaped organs in vertebrates. They are positioned at the left…
Q: Sea otters importance
A: Introduction: Marine animals known as sea otters (Enhydra lutris) live along the coasts of the…
Q: Individuals infected with herpes simplex virus (HSV) mount protective antibody responses directed…
A: The complement system of our innate immunity depends on the protein C3. C3 is another name for the…
Q: Bison roamed free in an area along the eastern slopes of the Rockies, in what is now Banff National…
A: Gene frequency:- it is usually represent the percentage of the population that have one type of a…
Q: Some Terms Related to Growth Patterns Biotic potential Exponential growth Logistic growth Carrying…
A: Introduction Populations show different growth patterns. This growth pattern is depending on the…
Q: Is covid still deadly
A: Corona virus are large family of viruses, that are known to cause illness ranging from the common…
Q: 3 ways in which carbon dioxide is transported by the renal vein
A: Cell metabolism in the mitochondria results in the production of carbon dioxide. The output is…
Q: How do the researchers propose to use cancer sniffing worms in real life
A: A disease in which abnormal cells devide uncontrollably and destroy our body tissues is known as…
Q: What 8 things are required to maintain life?
A: Introduction Biology is the science that investigates life. This may appear to be a foolish question…
Q: Could monkeypox turn into a pandemic
A: Monkeypox is the latest global public health threat caused by the monkeypox virus. The monkeypox…
Q: What does selective mean ? In biology
A: Introduction Biology is a branch of science that deals with the study of living organisms. Biology…
Q: Hame Aal@yah, M. How to Use Microscope and parts-The microscope you will use in bic microscope. It…
A: We may also use use a stereoscope which is used to view stereoscopic pair of separate images, as a…
Q: Individuals infected with herpes simplex virus (HSV) mount protective antibody responses directed…
A: 1. The alternative route is activated by Thr hydrolysis of C3 on the cell surface. In opsonization…
Q: If two unaffected parents have an affected child, they must be what of the gene
A: Given condition: Two unaffected parents have an affected child. This is possible only when both…
Q: Five conditions are required to maintain the Hardy–Weinberg equilibrium in a population. Closed…
A: Introduction: When a population rises Hardy-Weinberg equilibrium for the a gene, evolution ceases…
Q: A B C D1 Forest floor refers to the growth that is found directly on the ground in the forest. This…
A:
Step by step
Solved in 2 steps
- This reaction is exergonic because the reactants have more potential energy than the products.Why do some chemical reactions need to have a catalystAn exergonic reaction has which of the following properties? A) The △G is negative and the reaction is spontaneous. B) The △G is negative and the reaction is non-spontaneous. C) The △G is positive and the reaction is spontaneous.