Why is the formation of ATP by ATP synthase referred to as oxidative phosphorylation?   A. A phosphate is transferred from oxygen to ADP to form ATP   B. Oxygen provides the mechanical energy that is used to create ATP from ADP   C. Oxygen is the final electron acceptor in the electron transport chain, which creates the proton gradient necessary to power ATP synthase   D. ADP combines with oxygen to form ATP

Q: Question 37 of 45 Macmillan Learning The phrases or terms describe different fundamental processes…

A: Replication is the process in which both strands of DNA are copied to create two identical DNA…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: Which of these is/are true of the autonomic nervous system? Check all that apply. Check All That…

A: The brain, spinal cord, and a sophisticated nerve network are all parts of the nervous system. The…

Q: Select ALL of the conclusions that can be drawn from this graph. A Species 1 Seed size Select all…

A: Competition is the relationship where two species compete with each other to survive better.Here…

Q: words, describe the differences you see for each organism grown at 30 C or 37 C (i.e., amount of…

A: Microorganism have their own optimal growth at an optimum tempearture and pH. In these pictures, we…

Q: Models of real-world phenomena can reveal important links between structure and function in biology.…

A: Watson and Crick explain the double helical nature of DNA. According to this structure DNA is a…

Q: Cooperation and collaboration exist alongside competition during the process of scientific…

A: Cooperation and collaboration play crucial roles in the area of scientific exploration, particularly…

Q: evolution genetic variation Hardy-Weinberg equilibrium genetic drift adaptations sexual reproduction…

A: Evolution is the gradual process through which living organisms change over time, typically due to…

Q: platypus is one of a very small number of mammals that are venomous. Researchers compared the…

A: Most important part in this paragraph is that the two proteins are almost similar in function and…

Q: fossil of what you think is the common ancestor of the new species of ape and all other gorillas.…

A: The whole branch of biology which deals with  establishing the relationship between two species is…

Q: an F2 generation. If there are a total of 200 F2 flies, how many of the F2 females are expected to…

A: A character is autosomal linked when the gene is present on autosomes and the character is X linked…

Q: Give typed full explanation  Which of the following results in the production of ATP from ADP? a.…

A: ATP is adenosine triphosphate which is the source of energy for the use and storage at the cellular…

Q: The image attached is a drawing of a Columnar Epithelium slide with the 40x objective lens. There…

A: The lining of the digestive tract (stomach, small intestine, and large intestine), the respiratory…

Q: There are many common misconceptions about evolution. Which is TRUE about whale evolution?…

A: The ancestor of whale are most likely an ancient artiodactyl i.e. the four legged even tieds goofed…

Q: ich of the following answers are true about adenosine triphosphate (ATP)? Note, there may be MORE…

A: ATP stands for adenosine triphosphate. It is used as an energy currency in lot of metabolic…

Q: why do lionfish have a huge effect on biodiversity in coral reefs?

A: The number and variety of plants, animals and other organisms that live in an ecosystem is known as…

Q: In pea plants yellow seed color, (GG) and round seed shape (WW) seeds are dominant traits, while…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: A type of bird on an island makes nests in both tree roots and in tree branches at various heights…

A: Natural selection is an evolutionary mechanism. Organisms that are better adapted to their…

Q: In squirrels, the gray allele (G) is dominant to the brown allele (g) at the coat color locus. A…

A: The principle is the genetic  variation in a poulation will remain constant from one generation to…

Q: How do cells regulate enzyme activities?

A: Cells control enzyme activity in numerous ways to ensure that metabolic processes occur at the…

Q: A cultured mouse cell line has a mutation in a gene encoding a ribosomal protein. The mutant protein…

A: Chaperones are a kind of protein with similar properties that aid in protein folding. These proteins…

Q: Chemolithrophs near hydrothermal vents support a variety of other life forms there. Explain now…

A: Chemolithrophs are the microorganisms that generate energy by the oxidation of inorganic molecules…

Q: DNA replication is semi-conservative, this statement means that   Question 6 options:   a)  the…

A: DNA replication is the process by which double-stranded DNA is duplicated. The replication of DNA is…

Q: Predictors of Eating Disorders Which of the following is the most important predictor of an eating…

A: Eating disorders are intricate battles within the mind. In these types of disorders, there is…

Q: 1.Systemic arteries/arterioles 2.Systemic capillaries 3. systemic veins/venules 4. Lungs (or going…

A: Heart is a central pumping organ. Most of the blood is pumped by the heart to different parts of the…

Q: The electron transport system in bacteria involves: a proton motive force and oxidative…

A: The electron transport system, also known as the electron transport chain (ETC), is a vital process…

Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…

A: Since you have posted multiple questions, we will provide the solution only for the first question…

Q: For each combination of species, indicate whether the group they form would be monophyletic,…

A: Monophyletic, paraphyletic, and polyphyletic groups are three ways to classify groups of organisms…

Q: Draw fungal structural (spores) are mostly indicated with PINK stain (except in Image 5).

A: As per our company guidelines we are supposed to answer only first 3 parts. Kindly repost other…

Q: R Amp 8,000 Xhol 0 (or 12,000) PUC 18 12,000 bp 2,000 insert 4,000 EcoRI alone HindIll alone Xhol…

A: In molecular biology, restriction enzymes play a pivotal role in the analysis and manipulation of…

Q: Pax6 is a gene that is involved in mammalian eye development. Mutations in this gene result in a…

A: The comparison of the eyes of humans, mice, and flies supports this component of Darwin's…

Q: draw the Rhizopus and indicate the hyphae, zygospores, and sporangia. (Rhizopus combination) draw…

A: The Kingdom Fungi includes diverse eukaryotic organisms including molds, yeasts, and mushrooms.…

Q: Consider a gram negative pathogen isolated from marine mammals. This pathogen is subjected to a…

A: Here in this question we are given certain characteristics and on the basis of it we have to…

Q: carry the father’s genetic information

A: Genetic infromation refers to the informations which is stored in the DNA. DNA can code for proteins…

Q: Bacteria that prefer to grow at room temperature at low pH are: Mesophilic acidophiles…

A: Bacterial growth is influenced by many factors such as temperature, oxygen requirements, pH, source…

Q: what would the Pharmacokinetics and Pharmacodynamics be of an hullicinate drug like LSD that acts as…

A: LSD (lysergic acid diethylamide) is a well-known psychedelic that acts as a partial agonist at the…

Q: Deoxyribonucleoside triphosphates are the necessary and fundamental monomers for polymerization of…

A: This question addresses why ribonucleoside triphosphates (rNTPs) are required in addition to…

Q: C. What genotypes lead to the phenotypes of the F2?  What phenomenon is occurring in the F2…

A: Saccharomyces cerevisiae, bakers yeast is an model unicellular organism for genetic experiments. It…

Q: Match the items in the left column to the appropriate blanks in the sentences on the right. a higher…

A: The difference in equilibrium constants between fetal hemoglobin (HbF) and adult hemoglobin (HbA)…

Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…

A: Cellular respiration involves the breakdown of glucose and the production of energy in the presence…

Q: the following pairings of organelle-function are mistaken loroplast - photosynthesis ell membrane -…

A: It is a sub unit with in a cell that performs a specific function. They are tiny organs and plays a…

Q: • Put the name each stages of phagocytosis in the picture below:

A: Phagocytosis is a special type of cellular process that is used for ingestion and eliminating…

Q: In pea plants yellow seed color, (GG) and round seed shape (WW) seeds are dominant traits, while…

A: The allele G (dominant) is responsible for yellow phenotype and the allele g (recessive) is…

Q: efer to the image. A HAURS Gibbon (20 species in 4 genera) Prosimians: Bushbabies New World and…

A: It is a diagram that shows the evolution of various species, organisms from a common ancestor. It is…

Q: Identify the following: Description: Embryonic origin : Function : Location in the body:  1. Simple…

A: In the study of anatomy and biology, various types of epithelial tissues play critical roles in the…

Q: Q4.7. In DNA replication, what is the difference between the leading and lagging strands? In the…

A: DNA replication is a mechanism through which cells make copies of the genome's DNA. A cell must…

Q: Define the following terms: (2-3 sentences) 1. Metabolism 2. Glycolysis 3. Beta oxidation 4.…

A: Inside the living cells, biomolecules are constantly being synthesized aand trasnformed into some…

Q: Examine the table of characters given for four different species of flower. Species A Species B…

A: A primitive (or ancestral) character, trait, or feature of a lineage or taxon is one that was…

Q: Scientists working with DNA in vitro often store it in solutions that contain EDTA,a chelating agent…

A: As a chelating agent, ethylene diamine tetra acetic acid (EDTA) can bind to and create complexes…

Q: Organelle Plasma Membrane Nucleus Mitochondria Smooth ER Rough ER Golgi Body Ribosome Lysosome…

A: The fundamental structural and operational unit of a living being is a cell. In accordance with the…

Metabolic pathways

Metabolism is defined as the group of life-supporting, enzyme-mediated chemical reactions in organisms. A metabolic pathway is a set of these chemical reactions that involve anabolism (synthesis of complex biomolecules) and catabolism (breakdown of biomolecules into small molecules) that occur inside a cell. Metabolites are the reacting substances, products, and intermediate substances of an enzymatic process that are altered by a series of chemical events catalyzed by enzymes.