why the hemacytometer method is not compatible with mycelium b. Explain at what stage of growth the fermentation in the batch system is stopped
Q: You have a mixture of positive, negative and neutral proteins. In order to obtain a pure positively ...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Describe in as much detail as you can, the fluid mosaic model of a cellular membrane.
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: Give the name of the enzyme in this reaction along with detailed
A: Coenzyme A is a coenzyme which plays important role in the synthesis and oxidation of fatty acids, a...
Q: Matching type. Match the following disaccharides with their corresponding monosaccharide units Galac...
A: Disaccharides are the class of carbohydrates that consist of two monosaccharides joined covalently b...
Q: Explain the importance of knowing the conformation/structure of proteins.
A: Proteins are biomolecules composed of amino acids. The amino acids are joined together through pepti...
Q: why is there glucose 6-phospI n the ER lumen A. Glycogenolysis occurs in the ER lumen. B. It prevent...
A: Introduction: Glycogenolysis is the catabolism of glycogen to form glucose. The glycogen branches ar...
Q: What is the chemical difference between cellulose and chitin? Select one: a. Replacement of the hydr...
A: Cellulose is a structural polymer in the plant cell walls while chitin is the main structural polyme...
Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by
A: What is glycoproteins: Glycoproteins are molecules that comprise protein and carbohydrate chains tha...
Q: A catalase is an antioxidant enzyme that requires ferric ion for catalysis. Under conditions of iron...
A: - Option A- A prosthetic group is a non-amino acid component that is closely connected to the apopro...
Q: Iculate the actual, physiological deltaG for the reaction Phosphocreatine + ADP > creatine + ATP at ...
A: Disclaimer: Since you have asked multiple question, we will solve the first question for you. If you...
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions ...
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have...
Q: Provide one important function of activated APC?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: A protein has a tertiary structure formed by interactions between the side chains of the following p...
A: Two protein interacts with each other using side chain of interaction. Depending upon interacting si...
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids con...
Q: The type of linkages found between monomer units in nucleic acids is a ether b amide c p...
A: Introduction: Nucleic acids are molecules that store genetic formation for cellular growth and repro...
Q: Bradford technique
A: The Bradford assay is based on the use of the dye Coomassie Brilliant Blue G-250, sometimes known as...
Q: The protease used in this procedure functions best at 50°C. Would you expect this enzyme to be isola...
A: Microorganisms are classified as, psychrophiles, psychrotrophs, mesophiles, thermophiles, and hypert...
Q: Given the following protein: N-MACHKGFDSTRRKYWQNKRLCVSA|IDWQSPWKNQGILV-C The overall charge of this ...
A: (1)The ionizable groups in the given peptide at pH 7 are; N-terminal : it will have +1 charge Side...
Q: hat happened to the DNA at the different temperatures (95, 75, 55 degrees)? How does Polymerase Chai...
A: DNA is a double stranded polynucleotide chain ,the double stranded structure is formed by the comple...
Q: Which statement is true about GLUT1? GLUT1 transports glucose into erythrocytes against a concentrat...
A: Glucose transport is carried out by different transporters which are expressed in different forms in...
Q: Most of the ultraviolet absorption of proteins at 280 nm is due to their content of O Tryptophan O A...
A: Proteins in solution absorb UV light at 280 and 200 nm, exhibiting absorbance maxima at these wavele...
Q: II H3N-CH-C–NH-CH-C-NH-CH-C-NH-CH-C-NH-CH-C¬o II ČH,OH CH2 ČH3 CH2 H3C CH3
A: Peptide bonds are formed when the amino or NH2 group of one amino acid bonds to the carboxyl (acid) ...
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...
A: Glucose is degraded to pyruvate through the process of glycolysis that occurs in the cytoplasm. Pyru...
Q: What is the reaction mechanism of the reaction of amylase with starch
A: Amylase is an enzyme that catalyzes the hydrolysis of starch in to maltose , which is composed of tw...
Q: Branched polysaccharides will be more viscous than linear polysaccharides. True False
A: The molecular formula of glucose is C6H12O6. Glucose is a building block of disaccharides like ...
Q: Which of the following statements concerning structural characteristics of bile acids is CORRECT? * ...
A: Bile acids are a collection of acidic steroid molecular entities with unusual physical, chemical, an...
Q: In Figure 12-26, provide a biochemical mechanism forwhy HP-1 can bind to the DNA only on the left si...
A: The family of heterochromatin protein 1 (HP-1) consists of highly conserved proteins which perform a...
Q: When answering the questions below, please use the ONE-LETTER CODE for the amino acid, with NO space...
A: Trypsin and chymotrypsin are the proteases that break down protein into individual amino acid...
Q: Can a chemical reaction takes place without the application of enzyme or catalyst? Why or why not?
A: Introduction: A chemical reaction is a change in which one or more substances undergo conversion to...
Q: Below are the structures of three phosphate-containing molecules. Which one has the lowest Phosphory...
A: Phosphate group is containing one phosphate group atom attached to four oxygen molecule.Various mole...
Q: Propose a reasonable pathway to degrade the following amino acid to core metabolic intermediates. Me...
A: In the given amino acid structure, there is additional amino group in sidechain and structure is sim...
Q: unfold the protein
A: here they are talking about protein unfolding. The tension applied by the cantilever during protein ...
Q: Using a semi-permeable membrane, dialysis allows the removal of salt ions prior to chromatography. T...
A: Dialysis is a separation process that uses selective and passive diffusion via a semi-permeable memb...
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius - 7 cm; m...
A: Centrifuge is a device used for separating molecules having different densities. The process is call...
Q: What is the general definition of an uncoupler protein? In the context of oxidative phosphorylation,...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: A bowl of pasta contains 45 g of carbohydrates. How much energy can possibly be released after its c...
A: Total Carbohydrate in pasta = 45g Molecular weight of Glucose = 180 g/mol
Q: electrical conductivity
A: Here they are talking about electrical conductivity. The counterpart of electrical resistivity is el...
Q: What part of the electron transport chain is responsible for the greatest contribution to oxidative ...
A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport ch...
Q: You'lre hungoy, body Cmuttiple g the following e optim posei ble) which Occur in Our toonelete (A) À...
A: Hungryness is a feeling that stimulates food intake. There are number of pathways that stimulate goo...
Q: 4. The sequence of a peptide A formed by 16 amino acids was determined using a combination of method...
A: Proteins are chain of amino acids linked by peptide bond with release of a water molecule. Alpha car...
Q: write about a Famous Case of someone with Li-Fraumeni Syndrome
A: Li-Fraumeni syndrome is a rare hereditary disorder that predisposes carriers to cancer development. ...
Q: Consider three groups of solutes: (i) steroid hormones, fatty acids,and other lipids; (ii) inorganic...
A: The function of cell membranes is to organize and protect cells. The outer plasma membrane of every ...
Q: Show and explain how exactly the condensation reacti of a nitrogen base and sugar results to the Fig...
A: Condensation reaction- It is a type of reaction in which two molecules combined with each other and ...
Q: 4. The enzyme abundantly distributed in adipocytes and germinating seeds are A. proteases B. lipase ...
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: Given the active site diagram below, which best described the mechanism(s) of Active Site `NH2. SH O...
A: Acid-Base Catalysis: Here chemical reaction is catalyzed either by an acid or a base. Acid-Base &a...
Q: king of acid
A: Acid is the substance which turns blue litmus to red. Acid contains more H+ ions. Acids acts as prot...
Q: Which of the following is TRUE? Select one: a. The disulfide bridges formed by oxidation of the sulf...
A: The tertiary structure of the proteins is due to various interactions between the side chains in the...
Q: histidine has three pka values: pka=1.7 pk2=6.0, pka 9.1 a- for each pka, find the equilibrium cons...
A: Consider the acid dissociation reaction at equilibrium; HA⇌H+ + A- here 'HA' is the acid 'H...
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...
A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...
Q: Which statement(s) correctly describe(s) protein structures? A. All hydrophobic residues are buried ...
A: Proteins are made up of amino acids, which are the building blocks. Around 20 different amino acids ...
Step by step
Solved in 3 steps
- 1- given the facts of this case, what environmental factors is probably necessary for vibrio to grow adequately?1. While working with Mannitol Salt Agar you notice the growth of staphylococci however other microorganisms are growing as well. How would you interpret this?1. Determine the amount of dehydrated medium needed to prepare 50 nutrient agar plates. Include amount for 2 additional plates as excess to compensate for compounding losses. 2.
- 1. Give examples of specific applications for different types of solid tubed media 2. Give 5 examples of microorganisms that may be grown in Nutrient Broth. 3. Discuss the implication/s if the spore strip was missed out during the preparation of the sample for autoclave and possible remedy for this scenario.1. Draw and label the parts of the growth curve if it is exponentially growing and inoculated in the same nutritious medium under the same optimum conditions. Answer and draw this completely.Sugar fermentation (Mannitol): 1. Explain the incubation conditions 2. Explain the reagents being added 3. Explain the observations in sugar fermentation 4. Explain the interpretations in sugar fermentation
- Laboratory Report Sheet – ENZYMES Potato Peroxidase OBSERVATIONS: RESULT boiled potato extract + phenol + H2O2 boiled potato extract + catechol + + H2O2 boiled potato ex tract + Guiac + H2O22. Gamma-hemolysis on a blood agar plate would likely appear: Select one: a. As no change in the medium b. Blue c. Yellow d. Green e. As a clearing.1. Why does mold growth not measured turbidimetrically? Explain this comprehensively and please, do not just copy from somewhere.
- Discuss the unique capacity of the Deinococci to tolerate desiccation and high doses of radiationA culture consisting of 100 litres of nutrient medium containing 12 g l-1 of growth limiting substrate is inoculated with 10g of bacteria in a batch fermenter. The yield of biomass from substrate is 0.05 g g-1 . The maintenance coefficient is 2.0 g g-1 h -1 . The specific rate of product formation due to maintenance is 1.0 h-1 . The maximum specific growth rate of the organism is 0.3 h -1 . YPX= 7.7 and product formation is directly linked with metabolism. a) What is the time required to produce 15 g of biomass? !!!!! ANS IS 3.07 HRS!!!! STEPS on how to reach this pleaseDole Diversified North America, Inc. Announces Recall of Dole™ Fresh Blueberries for Potential Cyclospora Contamination Describe the cause of the incident and how they were able to trace it to the source. What illnesses did this lead to?
