With regard to transcriptional termination in eukaryotes, which model(s) suggest(s) that RNA polymerase is physically removed from the DNA by an exonuclease?a. Allosteric modelb. Torpedo modelc. Both modelsd. Neither model

With regard to transcriptional termination in eukaryotes, which model(s) suggest(s) that RNA polymerase is physically removed from the DNA by an exonuclease?a. Allosteric modelb. Torpedo modelc. Both modelsd. Neither model

Name: With regard to transcriptional termination in eukaryotes, which model(
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: With regard to transcriptional termination in eukaryotes, which model(s) suggest(s) that RNA polymerase is physically removed from the DNA by an exonuclease?a. Allosteric modelb. Torpedo modelc. Both modelsd. Neither model

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 14P

See similar textbooks

Similar questions

Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c) AAATCTACTACGATT d) GGGTTGGGTTGGGTT
Process by which the DNA sequences encoding exons are exchanged and reordered through genetic recombination between DNA sequences encoding introns. Group of answer choices a)RNA editing b)Exon Definition c) Exon Shuffling d)Transesterification
Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent ρ-independent termination? B. What types of mutations would prevent ρ-dependent termination? C. If a mutation prevented transcriptional termination at the end of a gene, where would gene transcription end? Or would it end?
Tautomerization: A. Causes frameshift insertions B. Causes frameshift deletions C. Results in permanent chemical changes in nitrogenous bases D. Cause transition mutations E. Cause transversion mutations
You are studying the rate of transcription of a particular eukaryotic gene. When the DNA located several thousand bases upstream from the gene is removed, the transcription rate of the gene decreases dramatically. How would you interpret these results?
How does transcription resemble DNA replication? a. In both processes the new nucleic acid is synthesized in the 3' to 5' direction. b. Both start at promoters. c. Both require ribonucleoside triphosphates, the building blocks of RNA. d. a and b, but not c e. a, b, and c
After being irradiated, the gene coding for the E site is mutated, causing the E site to have a greater attraction for tRNA. a)Which process will be most directly affected by this mutation? DNA replication Transcription Translation b) Justify your answer to the question above, by describing the effects of the mutation on the process you chose
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted
Give two DIFFERENT examples of how the following can occur:a. A point mutation in an exon that is silent.b. A point mutation in an exon that is NOT silent.c. A point mutation in an intron that is NOT silent.d. A point mutation in a promoter that is NOT silent.
f you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen at the RNA level? A-Nothing, because the RNA would be made as usual B-Transcription factors would be unable to bind and the RNA polymerase would not be recruited to the DNA, so no RNA would be made. C-The mutation of the DNA would be carried through to the RNA sequence. D-The DNA helicase would not be able to recognize and bind the DNA, so the RNA would not be made. EXPLAIN WHY THE ANSWER YOU CHOOSE IS CORRECT
What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsense
Gene expression in bacteria is controlled by the operon model. a) Why is the operon model important? b) Why is the trp operon known as a repressible operon?