write python programm function does the addition process when I type the word def 1- When you type the word “Enter" 99 2- directly
Q: write r program
A: c)R program to find all prime factors on n (prime factor as PF ) PF <- function(n) { if (n>=2)…
Q: Good Programming practices help in improving programs readability and understandability both for a…
A: Step 1:- Program:- #include<iostream>using namespace std;int f(int n);int main(){int n;cout…
Q: Good Programming practices help in improving programs readability and understandability both for a…
A: Programs are used to solve complex problems and to perform various tasks according to the…
Q: Write a calculator program can performed addition, subtraction, multiplication. division, mode,…
A: C++ calculator
Q: Create a function that will perform the following: 1. A sample program for basic input and output…
A: C is an imperative procedural language supporting structured programming, lexical variable scope and…
Q: 1. Trace the following function. Do not just provide the output. Include the state of memory for…
A: Python Memory Usage Information: Python allows displaying the memory storage information where the…
Q: 8. The Taylor's series for cos (x) is given as: (-1)¹x2n x² x4 (2n)! cos(x) => n=0 1 + - 2! 46 -- 4!…
A: According to the information given:- We have to write a program for Taylor’s series for cos(x) .
Q: Rewrite the following code using while loop statement instead of for loop statement in C++. #include…
A: We need to rewrite the program using while loop in the place of for loop. Here the loop ranges from…
Q: write python programm function does the addition process when I type the word def 99 1- When you…
A: Summary: In this question, we have to print the addition of two numbers in two different ways. Below…
Q: Good Programming practices help in improving programs readability and understandability both for a…
A: The following are the changes done in program: Ask the user to enter the number. change the…
Q: Print the following patterns using loop in C++: * ***…
A: Given data is shown below: Print the following patterns using loop in C++: * ***…
Q: Code the c program that prints the number of letters of a city name entered from the keyboard.…
A: /*C program to prints the number of letters of a city name entered from the keyboard*/ //include…
Q: Qno.4 Write a C++ program which take two 4 x 4 matrices and add them aske user whether to add or…
A: #include <iostream>using namespace std;int main(){ int r=4,c=4, M[4][4], N[4][4],…
Q: write code to perform write() read() append() all operations in a single program by system calling.
A: let us see the answer : Write() This function reads the entire file and returns a string. f =…
Q: 6: forLoops.cpp) a) Print the even numbers between 3 and 43. b) Print every third letter starting…
A: void a() { int i; cout << "a() ->" << endl; for(i = 4; i < 43; i += 2) { cout…
Q: Q8: Write a C++ program, using function, to calculate the factorial of an integer entered by the…
A: Note: As per policy we have to answer one question only. Please resubmit the second question with…
Q: e a Python program to combine two dictionaries into one by adding non keys. Input contains two comma…
A: Below is the detailed and simplified python code for the given problem statement:
Q: State true or false. Is indentation is enforced in C a. False O b. True
A: Indentation is not mandatory in C.
Q: c) Re-write(convert) the following C++ code using do-while loop instead of for-loop and write the…
A: Loop are used to repeatedly perform some task based on some conditions. There are various types of…
Q: 5. Calculate 1 + 2 + ... + n using recursive calls of functions. CA C:\WINDOWS\system32\cmd.exe…
A: The programming methodology is given by: Including header files Function prototype for result Main…
Q: Write function area(double r) which prints the area of the circle with the given radius r. Write it…
A: We have to find the area of a circle and make a function area which prints area in JAVA
Q: PROGRAMMING LANGUAGE: C++ Write the program using the discussed sample program that will give the…
A: Algorithm Start Var num Print("Enter a number less than 10") Accept num If(num<10) go to step…
Q: String: I am a student of PF in FAST-NU.
A: EXPLANATION To separate words from tokens first locate the space. First, take an empty string s1.…
Q: The Intermediate code generated below is for a given statement M-p*q+r/s is as follows: T1 = id5 T2…
A: Code optimization: This phase removes unnecessary code line and arranges the sequence of statements…
Q: Write a function, ftoa, to convert a real number to a string. Write a main function that reads…
A: Your C program is given below as you required with an output.
Q: 4. Trace the following function. Do not just provide the output. Include the state of memory for…
A: Given program: def g(n): print(n) if n == 2: print ("finished") else: print…
Q: Q1- Write computer subroutine program doing arrangement three values in ascending then print the…
A: Answer
Q: ank in C
A: EXPLANATION isspace() is a function that is used to check if a particular character is in space or…
Q: Write a Python program that replaces the last element of first list with second list. Sample Input…
A: Input List_one Input List_two Delete last element Append each item from Lit_two to List_one
Q: In C++ take input two char variables from user and find the difference between their ASCII value.…
A: Code: #include <iostream>using namespace std; int main() { //declaring required variables…
Q: It contains a function that takes two integers and calculates the sum as follows: We want to write…
A: Since there are two questions and as per our guidelines, we can answer only one question. So, we…
Q: Hw:Problem :write algorithm to add three numbers?
A: Input: 3 numbers Process: Adds all 3 numbers to Sum Output: Sum
Q: Writea C++ code (using a function) to read an integer value time (T) and convert it to equivalent…
A: Q1. Algorithm Start int time, min, hour Print("Enter time") Accept time hour=time/60…
Q: e a C function with th rFindSimilar(char str n two strings str1 an lar" to str2. Two strin
A: #include<stdio.h>#include<string.h>//This is the function which will returns the…
Q: Good Programming practices help in improving programs readability and understandability both for a…
A: PROGRAM CODE: Following is the program code with improved readability and understandability:…
Q: Write a Python program to reverse a given tuple.
A: 1. list(<tuple_name>) -> this function is called to convert the tuple into list. example-…
Q: (c) Re-write(convert) the following C++ code using do-while loop instead of for-loop and write the…
A: code conversion rm or loop to do while loop
Q: Pleaseuse python to write function which convert numbers to letters. For ex: #1->a #2->b #26->z…
A: Python used to answer this question.
Q: 5) Write a python function that swaps two integers. An example of calling the function is shown…
A: To swap two numbers storing in variables x and y, we use third variable t. Steps are Assign the…
Q: This is for Python version 3.8.5 and please include pseudocode. Write code to receive the value…
A: The program declares a function called multiply which takes 2 numbers as input. This function will…
Q: write the programm with given instructions
A: double average(double x,double y) { return (x+y)/2; } int wholePart(double x) { intnum = x;…
Q: Write a python function that will perform the basic calculation (addition, subtraction,…
A: Required: Must show it in Python:
Q: A Python function does not modify the data passed as a parameter when it is of type int, float or…
A: A python function does not modify the data passed as a parameter when it is of type int, float, or…
Q: Good Programming practices help in improving programs readability and understandability both for a…
A:
Q: Study the block of codes below: int main() { char s[] = "Get organized! Learn C!"; }…
A: Error in this code when at the main function of end add some code like example int main(){…
Q: Write function area(double r) which prints the area of the circle with the given radius r Write it…
A: Required: Write function area (double r) which prints the area of the circle with the given radius…
Q: Write python function to take 3 numbers as input and return maximum number as output Please only…
A: HI THEREBELOW I AM ADDING PYTHON CODE AS PER REQUIREMENT PLEASE GO THROUGH ITTHANK YOU
Q: Study the block of codes below: int main() { char s[] = "Get organized! Learn C!"; }…
A: The string may be printed using the printf function with the percent s format specifier. This will…
Q: Convert Lowercase to Uppercase in Python Without using Function in python also explain program.
A: The answer of the question is given below
Q: Find the errors from the following code and write the corect program. Each program has hwo errors
A: As per company guidelines we are suppose to answer only 1 question. Kindly re-post other questions…
Step by step
Solved in 4 steps with 3 images
- void change( int a[]) , the compiler converts the parameter to: Select one: a. int *const a b. int &a; c. int a d. const int a; c++C PROGRAM Create a c program that will convert number figures into words 1. You can use user-defined functions, string, array, and loops 2. Maximum input limit is 10000.00 Sample output (bold letters is for input) Enter amount in Peso: 143.50 You just entered P145.50 equivalent to One Hundred Forty Three and Fifty Centavos. Do you want to convert another amount? [Y|N]: N1. Use C PROGRAMMING LANGUAGE ONLY 2. Use RECURSION type of program 3. Copy and paste your code(no need screenshot) 4. Screenshot the output 5. It should be USER-DEPENDENT 3. Write a C propram containing a recrsive function that will get the whole number quotient resull of dividing wo.integers n and m. (Example if ne and m- 3, 4/3 #1. Output 1)
- Programming Language: Python 2. Write a Python function that takes three integers as arguments and returns the value of the largest one.C++ - No library functions like atoi Write a machine language program to input two one-digit numbers, add them, and output the one-digit sum. Submit your "machine code" followed by a 'zz.'Computer Science QuestionIn input you are provided with two words of the same length. Each word contains only lower-case alphabets. A shift operation will remove the first character of a word and add the same character at the end of that word. Your goal is to develop a python program that outputs the number of shift operations required on the second word to maximize the length of the longest common prefix of both the words.Test Case:5ccaddbddccOutput:3
- C++ - No library functions like atoi Create a machine code program to input two one-digit numbers, add them, and output the one-digit sum. Submit your "machine code" followed by a 'zz.' User Input one: 3 Input two: 4 Output the one-digit sum: 7 zzStack using C++ programmijng language please Write a program to input an arithmetic expression, then 1. Match nested brackets found the expression, if they are matched correctly proceed to step 2.2. Evaluate the expression. Please not that the operands of the expression may contain more than one digit. just 3 function : 1.function to check the brackets 2.function from infix to postfix 3.function to evaluate the expression this is the cin of the arithmetic expression is : ((5+(6/2*3)-2)+1)= you can use this function also ::: struct node { int data; node *next; node(int d,node *n=0) { data=d; next=n; } }; class stack { node *topp; public: stack(); void push(int el); bool pop(); int top(); bool top(int &el); //~stack(); //void operator=(stack &o); //stack(stack &o); }; stack::stack() { topp=0; } void stack::push(int el) { topp=new node(el,topp); } bool stack::pop() { if(topp==0) return false; node *t=topp; topp=topp->next; delete t; return true; } int stack::top() {…C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
- Stack using C++ programmijng language please Write a program to input an arithmetic expression, then 1. Match nested brackets found the expression, if they are matched correctly proceed to step 2. 2. Evaluate the expression. Please not that the operands of the expression may contain more than one digit. just 3 function : 1.function to check the brackets 2.function from infix to postfix 3.function to evaluate the expression this is the cin of the arithmetic expression we will use : ((5+(6/2*3)-2)+1)= this will give you 13 and will go to next stage (5+(6/2*3)-2)+1)= this will give you missing open bracket ((5+(6/2*3)-2)+1= this will give you missing close bracketInstructions The python "try" keyword is very powerful in that it can, among other things, prevent a program from ending abnormally because of invalid numeric input. Write a python program with two functions/modules that does the following: .main() accepts input and calls a function to test if the input is a number and displays a message regarding the result of that numeric test • numTest() is passed an input string, tests to see if the string is numeric and returns the necessary information to main() . a NULL input (just pressing the enter key) ends the program . DO NOT USE THE BUILTIN PYTHON FUNCTION FOR NUMERIC TESTING Be sure to use clear prompts/labeling for input and output.4. Odd-Even-inator by CodeChum Admin My friends are geeking out with this new device I invented. It checks if a number is even or odd! ? Do you want to try it out? Instructions: In the code editor, you are provided with a function that checks whether a number is even or odd. Your task is to ask the user for the number of integer, n, they want to input and then the actual n number values. For each of the number, check whether it is even or odd using the function provided for you. Make sure to print the correct, required message. Input 1. Integer n 2. N integer values
