XBT is a gene that controls the development of the body, specifically by determining the number c limb structures formed in the A. carolinensis lizard. What type of gene is XBT? noncoding O housekeeping toolkit constitutive

XBT is a gene that controls the development of the body, specifically by determining the number c limb structures formed in the A. carolinensis lizard. What type of gene is XBT? noncoding O housekeeping toolkit constitutive

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter17: Developmental Genetics

Section: Chapter Questions

Problem 10TYU

See similar textbooks

Related questions

Q: 1. Account for the success of parasitic flatworms. Cite specific strategies to support your answer.…

A: Please follow step 2 for detailed explanation.

Q: "Consider the arrangement of the following four normal chromosomes from some hypothetical organ…

A: Mutation is defined as any change in the DNA sequence of any organism. It can result due to error in…

Q: To summarize: The concept of energy flow through a food web.

A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…

Q: owl, barring (B) is sex-linked and dominant, the recessive allele (b) producing solid black color…

A: Sex linked character is usually present on the sex chromosomes which are either in the form of x or…

Q: 0.0 1.0 0.0 3 0.0 0.0 1.0 4 0.5 0.25 0.25 5 0.25 0.25 0.5 0.25 0.5 0.25 7 0.33 0.33 0.33 8 0.04 0.32…

A: According to Hardy Weinberg equilibrium- p2+q2+2pq=1 Where, p= frequency of the dominant allele in…

Q: 1. Use the observed genotype frequencies from Day 7 data to calculate the frequencies of the C…

A: Hardy Weinberg equilibrium is present when population is of large size and random mating is present…

Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…

A: As stem cells are the cells which have the ability to divide and can give rise to many different…

Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…

A: Polythiocarbamide ( PTC ) is bitter chemical compound . Sone individual able to taste it while other…

Q: 2. A nursing mother who has an alcoholic drink secretes alcohol into her milk for two to three hours…

A: Alchohol consumption leads to decrease in hormone production.

Q: GENERAL BIOLOGY 2 Q1 : How can plants reproduce naturally?? A. Using anthers B. Using cuttings C.…

A: plants reproduce naturally by Using runners.…

Q: How are antibodies to Salmonella H antigen produced? A) antibodies to H antigen are isolated from…

A: The antibodies are produced by the B cells of the vertebrate body. The B cells are present in the…

Q: Helen is a 62 yo smoker. Her physician has dignified her as having emphysema that has caused her to…

A: Given: Blood pH=7.40 To explain: To explain about pH level of a person and its effects

Q: Glycogenolysis is considered to be which of the following? Group of answer choices an example of…

A: Metabolism is a phenomenon takes place inside the body of an organism in which material are either…

Q: 4. Describe the process of alternation of generations using any plant phylum as an example. In your…

A: Introduction :- In plants and algae, the most common type of life cycle is generational alternation.…

Q: QUESTION 3 You are a clinical geneticist who is evaluating a newborn female child with a congenital…

A: The female child has two X chromosomes and 44 Autosomes. The number of barr body is determined by…

Q: owl, barring (B) is sex linked and dominant recessive allele (b) producing solid black color when…

A: Sex linked Allele is present on the sex chromosome that is usually on the X chromosome. Autosomal…

Q: Will the plate and breed count of the same milk approximate each other? Why or why not?

A: A Plate count method is used for identifying the number of cells which are actively growing in a…

Q: f your 16x concentrated stock solution contains 20g of Nacl per liter, how much Nacl would one liter…

A: Given:- Concentration of stock solution= 16X NaCl required per litre= 20g NaCl required for 1 litre…

Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…

A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…

Q: Please you explain why the answer is true or false for this question.

A: In biology, evolution is the process of a species' features changing over numerous generations by…

Q: abel the muscles on the dorsal and ventral sides of the frog. 1 2 10 3 11 12 13 14 15 8 16

A: Frog muscles: In frogs different types of muscles can be found that help the frog in performing…

Q: ANSWER THESE QUESTION; Click Edit DNA and make a substitution mutation that changes the first base…

A: Original sequence- ATG CCA GGC GGC GAG AGC TTG CTA ATT GGC TTA TAG Edited sequence- changes the…

Q: The intracellular matrix differs from the extracellular matrix in that the latter is located A…

A: Q. The intracellular matrix differs from the extracellular matrix in that the latter is located A…

Q: Match the pieces of the negative feedback arc that regulated the increase in stroke volume seen…

A: Answer given in step 2. Thank you.

Q: To describe: The ecological niche of humans.

A: The intended function that an organism performs within an environment is its niche.The biotic…

Q: what are the differences between the three-domain and five-kingdom schemes of biological…

A: The Linnaean system (1758) classified all macroscopic living organisms as either Animals or Plants,…

Q: Some substitution mutation result in a malfunctioning protein but others do not. Why is this?

A: A mutation is a change that occurs while copying or trying to replicate DNA molecules, resulting in…

Q: A cephalosporin that may cause a CU Ceftriaxone O a. O b. Cefaclor O c. Cephalexin O d. Cephamycin

A: Cephalosporins are a type of broad-spectrum, chemically synthesized -beta-lactam antibiotics and are…

Q: The addition of monomeric units to one end of a polymer and their removal from the opposite end such…

A: Introduction The cytoskeleton of a cell is made up of intermediate filaments. actin filaments and…

Q: I. lipase II. hydrochloric acid III. pepsinogen A. I only В. I only C. I and II only D. II and III…

A: Gastric juice is secreted by the stomach wall when stimulated by the hormone gastrin. When initially…

Q: To determine: The percentage of women who were not infected with any type of cancer-causing HPV who…

A: In this study, the researchers aimed to establish a link between the prevalence of multiple HPV…

Q: Mike is a 34-year old male who reports to the ER after a motorcycle accident. MRI results show that…

A: In a person that has transected spinal cord injury between T1 and L1, it would have paraplegia.

Q: 1. A package of nuts contains 3 servings, and each serving contains 150 calories. If you eat the…

A: A calorie is a unit of energy. It refers to the energy people get from food and drink they consume.

Q: Phosphorylase kinase integrates signals from thecyclic-AMP-dependent and Ca2+-dependent…

A: Phosphorylase kinase which is abbreviated as PhK, has the responsibility to coordinate hormonal as…

Q: Describe the function of the key Agrobacterium proteins involved in the transfer and integration of…

Q: 10. Phagocytosis by a phagocyte is required for: a. B cell action d. all of the above b. helper T…

A: Answer

Q: Explain in 3 paragraphs Charle’s Darwin Theory of Descent Modification

A: Years and years of Evolution have led to the world that we live in right now. Evolution refers to…

Q: Homing and navigation in salmon (across developmental stages; e.g., from stream to ocean and back to…

A: Homing in migrating fishes, such as salmon, can be defined as a behavioral pattern in which an…

Q: Consider the similarities and differences in the cell cycles (mitosis and meiosis) of plants and…

A: Mitosis and Meiosis similarity 1. Both occur during cell reproduction. 2. Both occur in stages.…

Q: 6. The physiological action(s) of insulin is (are): I. To increase glucose uptake II. To increase…

A: Insulin is a peptide hormone produced by beta cells of the pancreatic islets, and it is regarded as…

Q: Give at least 5 observations from the structures based on fish dissection?

A: Given: For the fish dissection procedure one would require, Medium sized - fish to visualize all the…

Q: Describe briefly the Trp operon? Why is it considered an example of negative regulation?

A: An operon is a cluster of genes that are transcribed together to give a single messenger RNA (mRNA)…

Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…

A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…

Q: For the number 7.31000 Convert the number to Scientific Notation. If you add1 to the last position…

A: Given number is 7.31000 To do= add 1 in the last position and convert it into scientific notation.

Q: What information does the Shannon index provide? What different factors should you consider before…

A: The Shannon diversity index calculator is a tool that may be used to estimate species diversity in a…

Q: Give an example of a physiological adaptation using organs and/or tissues of an organism of your…

A: A metabolic or physiologic adjustment within an organism's cell or tissues in response to an…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: Identify the different components of the mammalian (human) blood, describe each and give their…

A: The circulatory system is a system that contains the heart, blood vessels, and blood, and blood is…

Q: How are antibodies to Salmonella H antigen produced? A) antibodies to H antigen are isolated from…

A: Salmonella is a bacteria. It has H antigen on the flagella. It is a slender thread like portion on…

Q: Barr bodies inactivate Xic on autosomes. O are formed in female somatic cells O are formed in female…

A: Barr bodies is an inactivated X-chromosome. It is present in a cell that contains more than one…

Question

XBT is a gene that controls the development of the body, specifically by determining the number c
limb structures formed in the A. carolinensis lizard. What type of gene is XBT?
noncoding
housekeeping
toolkit
constitutive

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Other options

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

if you replaced the hox genes that are normally expressed in a dolphin fin with the hox genes that are normally expressed in a cat's paw, you would get a dolphin with kitty cat paws. ( True or false)
Besides a mutation for red color, what other mutation occurred in the lizard population
Each of the vertebrate Hox genes is present in 4 copies of the genome (TRUE or FALSE)
The gene for fangs is recessive, yet most of the dragons have fangs. How can this happen? [Hint. The gene that causes dwarfism (achondroplasia) in humans is dominant
If a gene is located on the X chromosome of a mammal,it isa. expressed only in females.b. expressed only in males.c. sex-linked, with females more likely to show recessive traits.d. sex-linked, with males more likely to show recessive traits.
Which of the following is NOT true regarding Hox genes. A) The sequence they appear in their corresponding chromosomes is the same order of their expression along the front to back of the developing animal. B) Homologues of the same Hox genes found in flies can be found in humans. C) Hox genes are only found in animals with bilateral symmetry. D) Animals with more complex body plans tend to have more sets of Hox genes through gene duplication events.
What type of genes regulate the development of anatomical segments and structures in an organism, directing the development of different body regions early in the organism's development? A. Homeotic genes B. Anatomical genes C. Allelic genes D. Methylated genes
In the Central Nervous system, Hox genes are involved in segemation of... ( Choices are cerebral cortex,cerebellum,mid-brain, or rhombomeres)
Which of the following statements about gene imprinting is correct?(a) Gene imprinting is a male reproductive strategy that can reduce the lifetime reproductivesuccess of females.(b) Gene imprinting is a female reproductive strategy that can reduce the lifetimereproductive success of males.(c) Gene imprinting is found only in placental mammals.(d) All statements are correct. A. (a) and (c) B. (a) and (b) C. (b) and (c) D. (d)
Which of the following sets of genes are most likely to have pleiotropic effects? Transcription factor genes Metabolic pathway genes Pigmentation genes Circadian rhythm genes
A mutation that alters the embryonic expression pattern of an _______ may lead to major differnces in the adult form. a. derived trait c. homologous structure b. homeotic gene d. analogous strcuture
The combination of genes present in the cells of anindividual is called the ___________.