The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the old one as a template O ribosomes do none of the listed choices make an ordered chain of amino acids in translation

Q: The activity of a cellular enzyme could be transiently altered by which of the following…

A: Phosphorylation is a process which activates the enzymes in function and leads to activation of…

Q: here is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods,…

A: In situ hybridization (ISH) is a type of hybridization that uses a labeled complementary DNA, RNA or…

Q: 1. What is the probability that one of the offspring will have the genotype DdEeFfggHHli? 2. What is…

A:

Q: How does natural increase, natural decrease, equilibrium affects or influence the population and…

A: Typically, population refers to the number of people in a certain place, such as a city or town,…

Q: Question 5 Describe briefly the TWO distinct roles of the v-SNARE and t-SNARE proteins in vesicle…

A: Role of SNARE proteins in vesicle transport :-

Q: I. CASE ANALYSIS. Read carefully the scenario below and answer the questions that follow. AAG Lys A…

A: Forensic analysis using DNA samples  The DNA sequences can be a helpful tool to determine the…

Q: Please you explain why the answer is true or false for this question.

A: In biology, evolution is the process of a species' features changing over numerous generations by…

Q: pure-breeding yellow (Y) canaries crossed with pure breeding blue (y)  canaries make green…

A: Inheritance is the process by which genetic information is passed on from parent to child.

Q: QUESTION 1 Loci Recombination Frequency (%) L and M 50 L and N 19 L and O L and P 50 50 M and N 50 M…

A: The test cross is done to find the genetic map. The crossing of unknown parent is done wit…

Q: To examine: Whether the statement “in the regulation of molecular switches, protein kinases and…

A: Small intracellular signalling molecules called second messengers are released in response to…

Q: Will the plate and breed count of the same milk approximate each other? Why or why not?

A: A Plate count method is used for identifying the number of cells which are actively growing in a…

Q: How might the following findings be understood in terms of the adaptive value of female mate…

A: This is a type of behavioural sexual selection in which the behaviour or the characteristics shown…

Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…

A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…

Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…

A: Proofreading by DNA polymerases avoids translesion synthesis by removing freshly generated…

Q: The probability of having an individual with a least a heterozygous gene pair on its genotype from…

A: The two genes are involved in this case. That's why it is a case of dihybrid cross.

Q: 10. Phagocytosis by a phagocyte is required for: a. B cell action d. all of the above b. helper T…

A: Answer

Q: Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mated to males with roof…

A: Answer given in step 2 onwards. As per our guideline i can answer only 3 subpart only but I gave you…

Q: The hydrolysis of ATP requires a. energy. b. water. C. a high temperature. d. energy and water. e.…

A: Answer is.. Water (b)

Q: MECHANISMS EXAMPLES 1. 1. Geographical Isolation 3. 1. 2. 2. Temporal/Seasonal Isolation 1. 2. 3.…

A: Temporal isolation is when species that could interbreed do not because the different species breed…

Q: escribe the behavior and neural mechanisms involved luring cricket communication used for…

A: Crickets are nocturnal, so they chirp at night. Male chirp to attract the female for mating.       “…

Q: In a few short sentences, describe the most widely accepted hypothesis concerning the evolution of…

A: Humans are different from other animals in many characteristics such as walking on two feet…

Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: What is the specific molecule recognized in our ELISA to measure phospholipase C activity? How is it…

A: Snadwisch ELISA method can be to measure phospholipase c activity can detect the level of PLCG2…

Q: What is the role of centrosomes during cell division? OA. to form the spindle fibers that attach to…

A: ANSWER;-D) to form the connection between two chromosomes Explain;- A centrosome is a cell structure…

Q: To explain: The way in which the plants with nodules for nitrogen-fixing bacteria might…

A: Nitrogen fixation is the process through which atmospheric nitrogen is converted to ammonia through…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA  contains the genetic information about the characteristics features of te organism present in…

Q: Create a food web of an Urban Ecosystem (UTAH) 1. Include: producers, primary, secondary, tertiary…

A: An ecosystem can be defined as a functional unit of nature, where living organisms interact among…

Q: What is the mode of inheritance shown in this pedigree? O a. Autosomal dominant O b. Mitochondrial O…

A: This is example of autosomal recessive disease

Q: How do you identify Enterobacter aerogenes for the Urea test?

A: Enterobacter aerogenes are gram negative;motile;rod shaped bacteria which are responsible for…

Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…

A: Social parasitism is interspecific parasitism.In this,two co species live in the same area and one…

Q: You have obtained the following pedigree chart I II III O IV O 1 2 Using the letters A or a or XA or…

A: Inheritance pattern is a pattern which determines how traits are passed from one generation to…

Q: 6. Describe one major event in Earth’s natural history. The event can be an evolutionary innovation…

A:

Q: Gamma globulins is synthesized in the liver True false plasma lipid is synthesis in the Kidney liver…

A: Please follow steps 2, 3 & 4 for detailed explanation.

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…

Q: Question 4 (1 point) Metabolism refers to burning food during physical activity like running.…

A: The true answer is... All of these (e)

Q: Gregor Mendel: CHECK ALL THAT APPLY conducted research that proved that the "blending hypothesis"…

A: Introduction Gregor Mendel:- He was an Austrian scientist, teacher, and Augustinian prelate who…

Q: 4. WATER HAS THE PROPERTY OF ADHESION, WHICH ALLOWS IT TO USE WHICH PROCESS IN PLANT ROOTS? A:…

A: Ans is.. capillary action

Q: 9. Coronary arteries route oxygen leH of the: d. descending aorta halpern round-a-bout a.…

A: Coronary artery supplies the fresh blood to the heart wall. It is of following types-Left anterior…

Q: I. lipase II. hydrochloric acid III. pepsinogen A. I only В. I only C. I and II only D. II and III…

A: Gastric juice is secreted by the stomach wall when stimulated by the hormone gastrin. When initially…

Q: ACP is specific of the pancreatitis O True O False is defect inglucuronyl transferase O Gilbert…

A: Acute pancreatitis is a pancreatic inflammatory illness that can occur all at once or in relapses.…

Q: PAMPS, TLRs, interferon

A: Human immunodeficiency virus (HIV) is a virus which attacks the human (body's) immune system.   it…

Q: Describe briefly the Trp operon? Why is it considered an example of negative regulation?

A: An operon is a cluster of genes that are transcribed together to give a single messenger RNA (mRNA)…

Q: Describe the function of the key Agrobacterium proteins involved in the transfer and integration of…

A:

Q: What is a trophic cascade? How do you integrate the concept into ecosystem management programs and…

A: Please follow step 2 for detailed explanation.

Q: in certain fish the mating of black-scaled (B) with white a white-scaled (W)  will create offspring…

A: Introduction :- Fish are aquatic vertebrate animals having gills but no digits on their limbs, such…

Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: CLASSIFICATION EXAMPLES FEATURES Domain Archaea Kingdom Phylum Class Order

A: The largest and broadest category of all groups in the classification of life is known as domain. At…

Q: 1. A package of nuts contains 3 servings, and each serving contains 150 calories. If you eat the…

A: A calorie is a unit of energy.  It refers to the energy people get from food and drink they consume.

Q: A community-based intervention program for hypertension was undertaken in two communities to compare…

A: Given: Hypertension is a prominent risk factor that poses global burden of diseases. It is most…

Q: Which of these molecules has multiple partial charges and thus is most soluble in water? H H HHHH…

A: Most soluble in water.