You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -35 region -10 region TATAAT Consensus sequence TTGACA Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100 0 B-Galactosidase activity Mutant 1 Wild-type Lac promoter Mutant 2 Mutant 3 Mutant 4 No promoter

You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -35 region -10 region TATAAT Consensus sequence TTGACA Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100 0 B-Galactosidase activity Mutant 1 Wild-type Lac promoter Mutant 2 Mutant 3 Mutant 4 No promoter

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT Group of answer choices 1.The mutation would inhibit the promoter thereby inhibiting transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would move the promoter away from consensus and reduce the level of transcription 4.The mutation would bind the promoter to the consensus and produce normal levels of transcription
You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind From the list given - choose all components that you think are part of a typical eukaryotic gene From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression
When a region of DNA that contains the genetic information for a protein is isolated from a bacterial cell and inserted into a eukaryotic cell in a proper position between a promoter and a terminator, the resulting cell usually produces the correct protein. But when the experiment is done in the reverse direction (eukaryotic DNA into a bacterial cell), the correct protein is often not produced. Can you suggest an explanation?
Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase the transcription rate are termed up-promoter mutations, and those that decrease the transcription rate are termed down-promoter mutations. As shown , the sequence of the −10 site of the promoter for the lac operon is TATGTT. Would you expect the following mutations to be up-promoter or down-promoter mutations? A. TATGTT to TATATT B. TATGTT to TTTGTT C. TATGTT to TATGAT
Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
The nucleus of a eukaryotic cell is much larger than a bacterium, and it contains much more DNA. As a consequence, a transcription regulator in a eukaryotic cell must be able to select its specific binding site from amongmany more unrelated sequences than does a transcription regulator in a bacterium. Does this present any special problems for eukaryotic gene regulation?
How do you think that transcription randomizes positions of nucleosomes and repression restores the ordering after transcription? How might you test to see if there was an exchange of histone subunits during transcription or if the nucleosome is truly transferred as a single unit? Would you expect the DNA band representing the distance from the restriction enzyme site to the hypersensitive site to be a single band or a smear? Defend your answer.
The DNA sequence of the promoter region of E. coli xyzA gene is shown below. Transcription start site is the A (in bold) at position 43. 5 10 15 20 25 30 35 40 45 50 GAGCT GTTGA CAATT AATCA TCGAA CTAGT TAACT AGTAC GCAAG TTCAC Mutations were introduced in the sequence to identify residues important for gene expression. Indicate the effect of the following mutations on xyzA expression (increase, decrease, no effect, cannot be predicted). Provide reasoning for each answer. A. G3A (G at position 3 was changed to A) G9A Deletion of TCA at position 18-20 C22A T31A, A32T double mutant T35G G45C C48A B. What are the promoter sequences of the gene?
Many promoter regions contain CAAT boxes containing consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
As discussed in the text, promoters were originally identified as consensus sequences upstream from transcriptional start sites. What additional evidence might support the assignment of these sequences as parts of promoters?
Wild-type E. coli grow best at 37oC, but can grow efficiently at temperatures up to 42oC. An E. coli strain has a mutation in the gene encoding rho protein that results in a stable protein at 37oC, but this mutant protein ceases to function at 42oC. When bacteria bearing this temperature-sensitive mutation are raised at 42oC, which of the following effects would you expect to see? Explain your reasoning for each of the 5 optionsa. Transcription does not take placeb. All RNA molecules are shorter than normalc. All RNA molecules are longer than normald. Some RNA molecules are longer than normal e. RNA is transcribed from both strands