You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -35 region -10 region TATAAT Consensus sequence TTGACA Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100 0 B-Galactosidase activity Mutant 1 Wild-type Lac promoter Mutant 2 Mutant 3 Mutant 4 No promoter
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps