G3A (G at position 3 was changed to A) G9A Deletion of TCA at position 18-20 C22A T31A, A32T double mutant T35G G45C C48A B. What are the promoter sequences of the gene?

Q: a man with depressive disorder is contributed in drug study that inhibit the b2 conversion to its…

A: A man with depressive disorder contributing in drug study that inhibits the conversation of b2 into…

Q: Bony fishes, frogs, and salamanders all produces eggs surrounded by a gelatinous layer and need to…

A: Phylogenetic tree A phylogeny is another name for a phylogenetic tree. It refers to the diagram that…

Q: What is a Ranvier knot? A.Region that closes on a GFP, when calmodulin and M13 interact in the…

A: Generation and transmission of nerve impulse is the characteristics of neurons that are the main…

Q: What is the difference between additive and compensatory morality? What is the difference between…

A: Please follow steps 2 & 3 for detailed explanation.

Q: M D

A: The crown and the root are the two anatomical sections of a tooth. The top portion that is exposed…

Q: Consider the following scenario: Molecule X is highly concentrated outside of a cell membrane.…

A: The transportation of molecules across the plasma membrane depends on their concentration gradient…

Q: Discuss the steps you would proceed after selecting your E. coli strain to prepare competent cells…

A: c) We can select the E. coli DH5α cells to prepare competent cells for cloning. The steps for the…

Q: what characteristics do you think make the "perfect fossil" to discover and for studying the past…

A: Fossils are the preserved remains of an organism. These are generally rocks in which organisms are…

Q: What is apoptosis? Explain cell signaling pathways that triggers it.

A: Introduction :  A multicellular organism's life cycle includes a crucial process called cell death.…

Q: explain the process of alcohol fermentation. having alot of touble understanding it

A: Fermentation is where microorganisms produce beneficial & desirable changes in food. The process…

Q: Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal…

A: Introduction :  Angiosperms are flowering plants that produce fruits with seeds inside of them. They…

Q: Answer these questions in a You may include labeled drawings or tables, if helpful. Short answers,…

A: Countless trillions of chemical reactions take place daily in our bodies to support vital metabolic…

Q: explain the evaluation criteria that would be used to check for the goodness of your solution to the…

A: There are a few important points about Ebola Virus : They belong to the virus of Filoviridae, virus…

Q: EDTA weakens the cell wall by removing ions that help hold it together while glucose prevents…

A: EDTA disrupts the outer membrane (enzymes that degrade DNA) by inhibiting DNases and chelating…

Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…

A:

Q: what is the reason for an individual to have fasting high HDL levels. list and explain reasons.…

A: Introduction:- HDL ( High Density Lipoproteins) is an essential and good form of the cholestrol…

Q: On the diagram below, i) draw where the uncoupling protein must be located and ii) indicate the…

A: Electron transport chain:  A series of protein complexes that are generally found in the outer wall…

Q: Empathy in prairie voles: Is this the consolation prize?

A: Empathy: Empathy is defined as the ability to understand other people's feelings and emotions. Some…

Q: In a study showing that approximately 10% of protein-coding genes are essential for Cell survival…

A: Human genome contains more proteins than number of genes. Not all genes are expressed at all times.…

Q: Determine how screening is carried out if pCR®II-TOPO® is used for cloning?

A: There are many applications of PCR as used in DNA fingerprinting to identify an individual from…

Q: A researcher would like to confirm whether the salmon purchased from the market is in LMO. Explain…

A: Organisms that have been genetically altered for increased yield, pest or disease resistance, or…

Q: Examples of ionizing radiation that are able to damage DNA and kill bacteria are Microwaves and…

A: Bacteria Or microbial pathogens can be killed by gamma ray, Ultraviolet rays, Radiowaves of…

Q: Which of these risk factors for cardiovascular disease is affected by exercise? - blood glucose…

A: The aerobic exercise includes activities such as brisk walking, biking, swimming and moving in the…

Q: The haploid number of chromosomes in a cell of a grasshopper is 18. How many chromosomes are in a…

A: A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's genetic code.…

Q: What cellular structures do eukaryotic cells have that prokaryotic cells lack? Select ALL that apply…

A: Introduction  The basic building elements of all living things are called cells. Prokaryotic and…

Q: The soil bacterium Agrobacterium tumefaciens, also regarded as 'nature's own genetic engineer', is…

A: As per our guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: The following picture shows the ethidium bromide-stained bands obtained by gel electrophoresis of…

A: Electrophoresis is a molecular technique that employs the electrical field to assort biomolecules,…

Q: Kwashiorkor Syndrome is a dietary deficiency characterized by decreased pigment in the skin and…

A: Biological macromolecules are the molecules that are needed in enough amount for the body. It…

Q: Match each statement with the best possible single answer from the list below. Terms may be used in…

A: Addition of TTGGGG repeats Correct match for this statement are - Telomerase.   Explanation…

Q: Neisseria lactamica Pseudomonas aeruginosa Pseudomonas fluorescens Pseudomonas putida Alcaligenes…

A: Bacteria are identified using various biochemical tests and staining techniques. The best example is…

Q: discriminate between protein coding regions and regulatory regions?(such as transcription factors,…

A: Exons and introns are divisions of genes in eukaryotes. The exons are known as protein-coding…

Q: Under anaerobic conditions, OA. lactate O B. oxygen O C. pyruvate O D. carbon dioxide E. glucose is…

A: Anaerobic and aerobic cell respiration are the two main forms of Cellular Respiration. One takes…

Q: Species that have undergone higher rates of change (long-branched taxa) tend to be linked…

A: LBA (long branch attraction) is a type of error wherein the distinctly related species are shown as…

Q: What is the importance of Carbonate/Bicarbonate buffer system for the oceans. What would happen if…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: DNAT  A  C       C  A  C        C  C  C       C  G  T         A  T  G        G  C  T      G  G  G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: Describe the feeding biology of centipedes, spiders, mites and beetles. Compare and contrast these…

A: We know that centipedes, spiders, mites, and beetles belong to the phylum Arthropoda and which is…

Q: Use the following information to answer the next question. Meiosis. Chromosome Content of Human…

A: The process of combining the male gamete, or sperm, with the female gamete, or ovum. The product of…

Q: Baltimore Oriole Black-backed Oriole Female Male Kondo, Baker, & Omland 2004 2B. Based on the…

A: The Baltimore oriole is a small icterid blackbird that is common in eastern North America as a…

Q: A shuttle vector is a vector constructed so that it can propagate in two different host speci One of…

A: Shuttle vectors are mostly plasmid vectors that are compatible with two host cells thereby allowing…

Q: Which of the following specifically explains why glucose uptake into intestinal cells happens in…

A: Active transport is selective and occurs against the concentration gradient. It is of two types…

Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…

A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…

Q: Why smooth muscles appears to have the largest nuclei? Isn't it skeletal muscle?

A: Introduction  There are more than 600 muscles in the muscular system. These comprise three different…

Q: How do Southern blotting, Northern blotting and Western blotting

A: in genetically modified organism all above three specific separation technique are used for genes…

Q: Explain the neural basis of the Hermann Grid Illusion?

A: Please follow step 2 for detailed explanation.

Q: 2) List the names of the two major Contractile Proteins. Which of the proteins is "bound" and…

A: 2 Given that it is composed of two phospholipid layers, the plasma membrane is known as a…

Q: A histological specimen of submandibular salivary gland represents basket * cells from which some…

A: Introduction :- Saliva is produced by salivary glands and maintains strong teeth while also…

Q: Purple (P) flower color is dominant to white (p) flower color. Cross two heterozygous parents using…

A: P allele encodes purple flower. It is dominant over p allele. The p allele encodes white flower.

Q: Q6.10. For a population containing 70 females and 30 males, what is the effective population size,…

A: Evolution is a steady phenomenon that cause transformation of life form from much simple to more…

Q: A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the…

A: SYBR TAQMAN Not so costly Expensive Easy to use Difficult to use Binding the fluorescent dye…

Q: From the DNA sequence data for the eight species (A through H) shown below, what is the genetic…

A: The DNA is the genetic material in living organisms that shows specific sequence of nucleotides. The…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.