Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?

Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 11QP: When the human genome sequence was finally completed, scientists were surprised to discover that the...

See similar textbooks

Similar questions

You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and…
Approximately what portion of the human genome is composed of repeat sequences?
Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic code would turn out to be composed of triplet sequences and be non-overlapping?Experimentally, how were these suppositions shown to be correct?
Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the amino acid sequences of all the proteins encoded by the genome of a certain species and have been asked to find candidate proteins that could bind dna. what type of amino acids would you expect to see in the dna-binding regions of such proteins?
On the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA?
Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?
What is the central dogma of biology? Describe the molecular processes that accomplish the flow of genetic information as listed by the central dogma?
As we described in class, in the early 1960's Francis Crick and colleagues set out to determine how many nucleotide bases make up a codon, before it was possible to sequence DNA and before Nirenberg and his colleagues solved the genetic code. To do this, they used a chemical mutagen that they knew made single nucleotide changes, used this mutagen to conduct a screen for mutations that disrupted a particular gene, and collected a number of different mutations in this gene. Briefly describe the logic they used to deduce that the codon length is 3 nucleotides long.
While characterizing a mutation in a gene of interest, you discover that the mutation involves an insertion within the coding sequence of the gene. You suspect that the inserted sequence is a transposon and would like to determine which of the three major transposon families it belongs to. What sequence elements could be looked for within the inserted sequence that would help place it in one of the three families?
If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
You have isolated a transposable element from the human genome and have determined its DNA sequence. How would you use this sequence to determine the copy number of the element in the human genome if you just had a computer with an Internet connection? (Hint: see Chapter 14.)