On the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA?

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: 4A.According to Watson-crick base-pairing rule-  Double-stranded DNA is complementary in nature that…

Q: What is meant by “Universality and Degeneracy” of the Genetic Code? What is the significance of the…

A: DNA have four bases, A, T, G and C, and proteins are made up of 20 different amino acids. Thereby…

Q: If a single strand of a gene contains 678 bases, how many amino acids result in the polypeptide…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: If the MC1R protein is 317 amino acids long, why are there 954 base pairs in the coding region of…

A: The proteins are produced by the amino acids that are produced by the translation process. During…

Q: What percentage of the human genome is nowpredicted to have functionality in at least one cell type?

A: The gene is the basic physical and functional unit of heredity. The genome is the genetic material…

Q: Mobile genetic elements, such as the Alu sequences, are found in many copies in human DNA. In what…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: which DNA sequences are commonly found at human centromeric regions?

A: The cell biology is considered as the study of cells, their structure, and their functions. The…

Q: What is the difference between core genome and pan genome?

A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…

Q: What proportion of exons are repeated sequences in the human genome? Is 38% surprising?

A: Human Genome is comprised of  only 1.1%  exons of the total, whereas 24% is in introns, and the…

Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…

A: 1.  Each amino acid corresponds to a codon and each codon is made up of sequence of three nucleotide…

Q: Why is the term “proteome” ambiguous, whereas the term“genome” is not?

A: The proteins are the essential part of living organisms and it consists of thousands of smaller…

Q: How many of each base is found in the complete double-stranded molecule?

A: The concept is based on Chargaff's rule. It is given by Erwin Chargaff to calculate the amount of A,…

Q: Can numerous paralogs in a genome lead to genome expansion? and how?

A: According to the question, we have to explain that numerous paralogs in a genome can lead to genome…

Q: Clearly, all humans have variations in their DNA sequences. How is it possible to sequence the human…

A: Answer- All the organism have certain amount of similarities in the DNA sequnece. In all the human…

Q: How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested…

A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…

Q: How many protein-encoding genes are in the human genome?

A: Genome refers to the genetic material of an organism, which consists of deoxyribonucleic acid (DNA).…

Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…

A: Genetics is the study of how traits are passed from one generation to another. This includes but is…

Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…

A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…

Q: Approximately what percentage of the human genome isderived from transposable elements?a. 10%b.…

A: Introduction:- Transposable elements are DNA sequences that have the ability to travel or transfer…

Q: The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how…

A: Recombination is the process of genetic reshuffling where the genetic material is shared within or…

Q: Approximately what portion of the human genome is composed of repeat sequences?

A: According to the results found in the human genome studies it is seen that the human genome has…

Q: How do we know if a genomic DNA sequence contains aprotein-coding gene?

A: Only about 1% of DNA contains protein-coding genes; the remaining 99 percent is noncoding. Noncoding…

Q: What are the frequency and percentage distribution of amino acids in the polypeptides coded by the…

A: The frequency and percentage distribution of amino acids in the polypeptides coded by the Original…

Q: The best estimate is that the human genome containsfewer than 21,000 genes. However, there is…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is…

Q: When the human genome sequence was finally completed, scientists were surprised to discover that the…

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: How many SNPs are in the human genome?

A: The human genome consists of about 3 million base pairs and 23 pairs of chromosomes. Out of these,…

Q: Why is the genome contained within a membrane?

A: A genome is a complete set of "genetic information" in an organism. It stores all of the information…

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Hemoglobin present in red blood cells helps in the transport of oxygen molecule to and from various…

Q: In humans, there may be three times as many proteins as genes. If each gene encodes a protein, how…

A: DNA gets condensed to form chromosomes during cell division. Chromosomes are rod shaped chromatin…

Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…

A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…

Q: What are transposable elements? Explain the mechanism by which they move from one location to…

A: A transposable element (TE or transposon) is a DNA sequence that may move around inside a genome,…

Q: Could a single nucleotide deletion restore the function of a protein-coding gene interrupted by the…

A: Introduction: The functional unit of DNA that code for proteins are known as genes.

Q: How many codons are there in the mutated DNA-(b) and DNA-(c)? What types of mutations occurred in…

A: Codon is sequences of three DNA or RNA nucleotides.

Q: Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she…

A: Introduction  A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?

A: DNA contains the instructions for protein synthesis. Proteins in turn determine structure and…

Q: What happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?

A: Gene is a stretch of DNA that codes for a particular polypeptide chain.

Q: Approximately how many Okazaki fragments are synthesized in thereplication of the human genome?

A: Okazaki fragments are short sequences of DNA nucleotides, which is synthesized during replication…

Q: What is the central dogma of biology? Describe the molecular processes that accomplish the flow of…

A: Central Dogma of Biology:                   The flow of genetic information from DNA to RNA which is…

Q: What is a genome and what is it composed of? What is thecentral dogma of molecular biology?

A: Genes are the hereditary units that are transmitted from one generation to another generation. The…

Q: For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides…

A: Transcription is the DNA dependent RNA synthetic process. RNA polymerase help in the transcription.…

Q: What is a nucleosome-free region? Where are such regions typically found in a genome? How are…

A: Given: Explain about the nucleosome-free region. and explain such regions typically found in a…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Blood is a body fluid that carries necessary nutrients and oxygen to the cells and transports…

Q: Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the…

A: Amino acids are the organic compounds that acts as the building block of protein molecules. Proteins…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Q: Nearly  _______of the Human GenomeConsists of Transposable Elements?

A: The transposable elements are the DNA sequence that may change its position or location within the…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.