Your company has decided to develop a PCR test that will be used to determine Huntington's disease. This genetic test will consist of a single PCR-amplification reaction of genomic DNA that will attach to the disease's gene either side of the repeated region to ensure amplification. Which of the following properties do you need consider when designing the orientation of the two primers relative to the template DNA? a) The primers’ 5′ → 3′ orientations must point toward each other when bound to the template. b) The primers’ 5′ → 3′ orientations must point away from each other when bound to the template. c) The primers’ 5′ → 3′ orientations must go in the same direction when bound to the template. d) The primers must be complementary to each other and to the template.

Q: A microbiologist discovers a new type II restriction endonuclease. When DNA is digested by this…

A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…

Q: please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the…

A: Ans: Chain termination sequencing: It is sanger sequencing method developed by Frederick sanger. The…

Q: Your graduate advisor asks you to amplify the following sequence of DNA by PCR:…

A: The primer should be complementary to the region of template to be amplified.

Q: If a pair of 10-mer primers are used in a PCR, what would be the number of expected binding sites in…

A: PCR is a polymerase chain reaction, in this process DNA is amplified . For this amplification,…

Q: Suppose that you would like to amplify the DNA sequence below by a PCR reaction. Design 8 nucleotide…

A: Primer is a shory stretch of nucleotides which binds to 3' end of template DNA. It provides free OH…

Q: Although many cloning applications involve introducing recombinant DNA into bacterial host cells,…

A: Cloning can be defined as the process by which identical copies of the organisms are created. More…

Q: Design as a set of primers, every 20 nucleotides in length. Using this sequence as a guide, design a…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: When half of the DNA in the sample is double-stranded, that point is termed the half- reaction time…

A: Cot values give the renaturation index of the DNA strands. Cot 1/2 value defines that 50%…

Q: You want to identify and compare the gene expression profile of several genes in a disease. Will you…

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: Why is it possible to visualize a PCR product on an agarose gel even if the template genome is…

A: Gel electrophoresis is a technique used in the separation of macromolecules such as proteins and DNA…

Q: Why did we obtain the sequence from the forward primers separate from the reverse primer?

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…

Q: is it possible that pcr primers could bind and amplify a sequence of dna that is difference from the…

A: Polymerase Chain Reaction (PCR) is a technique that gives us multiple copies of desired DNA…

Q: Extracting DNA From Strawberries Is isopropyl alcohol polar or nonpolar? Explain

A: DNA extraction is used to isolate dna molecule from the cells . It helps in removing impurities and…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17…

A: The bacteriophage is those viruses that have the capability to infect bacteria and reproduce inside…

Q: What are two factors that will determine the frequency at which a restriction endonuclease cleaves…

A: Restriction enzymes are the type of enzyme that is used to cleave the DNA during the molecular…

Q: complimentary sticky ends

A: DNA's are cut by using restriction enzymes ( endonuclease or exonuclease) which produce sticky or…

Q: For PCR, what property of DNA does temperature influence? Why do the “denaturation” and “annealing”…

A: PCR stands for polymerase chain reaction. It is an in-vitro laboratory technique used for generating…

Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…

A: DNA is the genetic material present in all living cells. It carries information from one cell to…

Q: Which of the following (A through E ) would you expect to find in a nucleotide chain constructed for…

A: Sanger sequencing is the method developed to sequence the short sequence of nucleotides base pair in…

Q: Which of the following is the best, and simplest, definition of recombinant DNA?

A: Answer:  RECOMBINANT DNA = This is the form of DNA which is made by using other other organism's DNA…

Q: Why  do the two possible PCR products differ in size by  300 base  pairs?

A: In in vitro conditions, a polymerase chain reaction (PCR) is a technique for making several copies…

Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…

A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…

Q: Which restriction enzyme used in your simulated electrophoresis experiment produced DNA with ‘sticky…

A: Restriction Enzymes or "Restriction endonucleases" are proteins that cut DNA at a specific base…

Q: In cloning human DNA, why is it necessary to insert the DNA into a vector such as a bacterial…

A: Plasmid are small, circular, extra-chromosomal, double stranded DNA molecule. They are capable of…

Q: In producing genetically engineered human insulin in bacteria, why is it important to use the…

A: Insulin is a natural peptide hormone produced by the beta cells of the pancreas in response to high…

Q: What are the consequences for a DNA sequencing reaction if the ratio of dideoxyribonucleoside…

A: Introduction  DNA is composed of nucleotides arranged in a specific sequence. Prior knowledge of DNA…

Q: are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from…

A: In gel electrophoresis DNA to be tested is broken down by various restriction endonucleases into…

Q: A person with a rare genetic disease has a sample of her chromosomessubjected to in situ…

A: The word insitu derived from the Latin word that means in place. This suggests that the…

Q: You are considering using restriction enzymes that recognizes 4-bp and 6-bp nucleotide sequences,…

A: From theory we know, the longer the restriction site recognized by a particular restriction…

Q: Ideal primers for the PCR reaction should have the following feature: they should have a high A-T…

A: Polymerase chain reaction (PCR) is a laboratory technique for rapidly producing (amplifying) large…

Q: The DNA of a deletion mutant of λ bacteriophage has a length of 15.4383 μm instead of 19.6356 μm.…

A: The mutation is the change in the nucleotide base pairs or in the DNA sequence which can be because…

Q: Four different pairs of PCR primers (in blue) are shown below. Each primer is shown in the location…

A: The “PCR primer” is the short piece of ssDNA of about 20 nucleotides in length. It is being used in…

Q: During PCR amplification in preparation for DNA sequencing, why were there different colors at the…

A: Polymerase chain reaction is a process by which millions of copies of a specific DNA segment are…

Q: The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: The region of the normal hemoglobin gene used for genetic testing for sickle cell anemia contains a…

A: in sickle cell anaemia [SCA], the RBCs get deformed and lose their biconcave structure which can…

Q: A 22-kb piece of DNA has the following restriction sites:A batch of this DNA is first fully digested…

A: The restriction enzymes clean the nucleotide fragment at specific sides called the restriction…

Q: Restriction enzymes cut double-stranded DNA _____.   a. at noncoding areas between genes   b.…

A: Restriction enzymes cut double-stranded only at specific sequence of the dna, producing either a…

Q: In conventional PCR applications, a heat-resistant polymerase is used. Why? You want to identify and…

A: "Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: You would like to amplify the gene shown below using PCR.  What is the sequence of the primer you…

A: Option d

Q: Why is a primer needed at each end of the DNA segment beingamplified by PCR?

A: Primer - Primer is a kind of short nucleotide sequence which is used as a starting point in the…

Q: If restriction endonucleases are produced by bacteria within a host, why don’t these enzymes chew up…

A: Introduction A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that…

Q: The restriction endonuclease recognizes and cleaves foreign DNA sequences at specific sites, while…

A: Restriction enzymes  A molecular scissor which is use to cut DNA at specific site.

Q: What are the three types of DNA ends that can be generated after cutting DNA with restriction…

A: A restriction enzyme, also known as a restriction endonuclease, is a bacterial protein that cleaves…

Q: You wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following…

A: The process of gel electrophoresis is done after the PCR for the qualitative analysis of the PCR…

Q: Suppose you were interested in generating a PCR amplicon including the bracketed sequence below.…

A: PCR or Polymerase Chain Reaction is a specialized type of method which is used to obtain copies of…

Q: How many fragments would you expect to be formed from digestion of a 2500 base pair long linear…

A: Given information: 2500 base pair long linear piece of DNA is the piece of DNA that is to be worked…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.