. Explain in detail the Shine-Dalgarno sequence.
Q: How would chymotrypsin's catalytic triad be affected by extremely low and extremely high pH values…
A: Enzymes are catalysts that increase the rate of the chemical reaction without undergoing any change…
Q: Explain briefly why the ionizable properties of amino acids are so crucial in the structure and…
A: Introduction Amino acids are a kind of nutrient. Proteins are polymers of nitrogenous chemicals…
Q: Given Poly-L-Lysine and Epsilon Poly-L-Lysine, which polymer(s) can easily dissolve in a saline…
A: Poly-L-Lysine are several types of lysine as homopolymers.Poly-Lysine enhances electrostatic…
Q: Which nuclear isotope used in protein NMR spectroscopy is the most sensitive to detect? Briefly…
A: NMR Spectroscopy is used to study the structure and composition of biomolecules like proteins. Here…
Q: Write the Structure Activity Relationship ( SAR) of Captopril ?
A: Captopril is an antihypertensive drug and is used for the treatment of renovascular hypertension. It…
Q: Define and give description of the importance of the isoelectric precipitation of proteins.
A: isoelectric precipitation or isoelectric point is the pH at which the net electric charge of the…
Q: You were asked to separate two proteins from one another by means of iso-electric focussing. The pI…
A: The molecules in a mixture are separated by exploiting their chemical or physical differences. In…
Q: Using condensed structures, supply an outline of the mechanism for the formation of Gly-Gly in the…
A: During peptide bond formation the carboxylic acids and primary or secondary - amines do not undergo…
Q: Discuss the absorption spectra of arginine
A: Absorption spectra were recorded covering wavelength range 200-900 nm using ultraviolet-visible…
Q: using the pKA table, determine the Isoelectric point of Arginine
A: The isoelectric point (pI) is the pH at which the net charge on amino acid is zero. Arginine is an…
Q: Explain amino acids being amphoteric electrolytes to form peptide bonds. State at least 5 general…
A: Biuret test is also known as Piotrowskis’ test. This test is used to determine the presence of…
Q: Discuss in detail the protein denaturation, how denaturation occurs at levels of protein structure?
A: A macromolecule refers to the polymer that is composed of monomers, which are linked together by…
Q: List and discuss the types of interactions that stabilize the tertiary structure of proteins. For…
A: A protein is a sequence of amino acids linked together. The basic sequence of amino acids that are…
Q: Lewis structures of molecules are important for finding small molecule drug candidates for diseased…
A: Lewis structures are also called as electron dot structure of a molecule. Small molecule drugs are…
Q: structure of valine at pH of 12
A: An amino acid is fully protonated at low pH, as the pH increases more than pKa of an ionizable…
Q: Two peptide sequences are shown below. Peptide A: N-term – GDL – C-term Peptide B: N-term – GTL –…
A: A peptide is a short chain of amino acids that contains one or more amino acids. Peptide bonds…
Q: a) Identify the five amino acids. b) Draw the three dissociation reactions for one of them.
A: Amino acids are organic compounds with functional groups namely carboxyl and amino. At low pH, amino…
Q: Give two benefits of utilizing the biuret reaction to assess protein concentration over directly…
A: A Biuret test is a generic test performed by molecules having two or more peptide links (CO-NH…
Q: Calculate the number of possible pentapeptides that contain one residueeach of Ala, Gly, His, Lys,…
A: A polypeptide that is bound together by amide bonds, is a continuous linear sequence of several…
Q: Concerning the peptide shown below identify five structural features.
A: Amino acids are organic compound having two functional group namely carboxyl and amino group.…
Q: whereas protein B does not absorb at 340 nm. What absorbance will be observed when light at 340 nm…
A: Given, ε (extinction coefficient) = 6440 M-1 cm-1 l (path length) = 5 mm = 0.5 cm c (concentration)…
Q: Explain about synthetic chemical 5-bromouracil (5-BU) ?
A: Mutagens are the chemical or physical agents that cause mutations.
Q: Some proteins migrate anomalously in SDS-PAGE gels. For instance, the molecular weight determined…
A: SDS-PAge is the method that separates the proteins on the basis of their molecular weight. It is an…
Q: (i) (ii) Draw the potential tautomers of guanine. Explain the potential risk of guanine (enol form)…
A: (i)The potential tautomer of Guanine is-
Q: Comment on why the feature ~210 nm in Circular Dichroism and Infrared spectroscopy is useful for…
A: Circular dichroism spectroscopy (CD) is a fundamental insightful method used to investigate…
Q: a. Draw the structures of tyrosine as different pH values. Please refer to the lecture notes for the…
A: Amino acids are monomers of protein they are linked with each other by forming peptide…
Q: Correlation between lipid profile and Covid-19.Explain this statement.
A: In December 2019, the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was discovered…
Q: Define the alternative chemical structure of deoxyribonucleic acid which could be copienfaithfully.
A: The Sanger chain termination sequencing method was invented by Sanger to identify the sequence of…
Q: Why different amino acids have different Rf values? If you separate a mixture of amino acids consist…
A: Paper chromatography is the separation technique where the mixture of the amino acids was separated…
Q: VizamylTM is used in brain scans for Alzheimer’s disease. Draw the structure of VizamylTM and…
A: VizamylTM is a molecular agent used in imaging the aggregates of β amyloid in the brain. It contains…
Q: Use examples to clearly Illustrate the meaning of the following terms and expression: (a) The Newman…
A:
Q: A biochemistry student characterizes the process of cooking meat as an exercise in denaturing…
A: Meat consist of various type of protein such as actin, myosin, etc., The myosin and actin play an…
Q: Hydrochloric acid, ethanol, acetone, nitric acid and picric acid are an agents of denaturation.…
A: A polypeptide protein is properly folded then only it is functional, If any change in its…
Q: Disulfide bonds help to stabilize the three-dimensional structure of proteins. What amino acids are…
A: Introduction Proteins are formed by 20 standard amino acids with limited amino acids availability…
Q: Sketch a titration curve for aspartic acid, andindicate the pKa values of all titratable groups.…
A: To calculate the pH range when the conjugate acid-base pair +1 Asp and 0 Asp will act as a buffer,…
Q: Identify the charge states for aspartic acid (Asp), leucine (Leu) and Lysine (Lys) at pH 1, 7 and…
A: Amino acids have two functional group amino group and carboxylic group. Aspartic acid: pKa1…
Q: What is the catalytic triad of chymotrypsin? Describe the mechanism of chymotrypsin in cleaving a…
A: Chymotrypsin is a digestive enzyme component of pancreatic juice acting in the duodenum, where it…
Q: [References] The peptide aspartame, shown in the sketch drawing window, has several ionizable…
A: Aspartame is a dipeptide which is used as artificial sweetener and is 200 times more sweet than…
Q: More ratios. Through the use of nuclear magnetic resonance spectroscopy, it is possible to determine…
A: From Henderson Hassel batch Equation pH = pKa +log [A*]/ [HA]
Q: Describe the principal biophysical and biochemical techniques used to study tertiary and quaternary…
A: The chain of amino acids where each amino acid is linked to others via a peptide bond is known as a…
Q: 3. a. Draw the structure (at physiological pH) of the peptide PEACH (note that this is one letter…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: t. Explain the process of affinity maturation. Why vould you expect affinity of Abs to continue to…
A: Affinity maturation is the process in which B cell is activated by TF cell, and production of…
Q: Explain the biological function of achieved by the coiling of polypeptide chains as well as the…
A: A coiled coil is a structural motif in proteins in which 2-7 alpha-helices are coiled together like…
Q: and observe the two structures determined below for interleukin 13. Write a short essay to discuss…
A: NMR (Nuclear Magnetic Resonance) Spectroscopy method use to detect local magnetic fields around…
Q: explain denaturation and its effect on proteins and thier function. also desribe three different…
A: Proteins are the polypeptides (polymers of amino acids) covalently linked by the peptide bonds. In…
Q: Protein: SHAYNERSE Predict the products of the following reactions with the protein given, if there…
A: Given protein SHAYNERSE is…
Q: Vitamin D3, the most abundant of the D vitamins, is synthesized from 7- dehydrocholesterol, a…
A: Provitamin is the substance that may be converted within the body. The human body produces…
Q: Determine the pI of the peptide H2N-Ala-Lys-Ser-Arg-COOH at pH 11, please explain why some pKas are…
A: Amino acids are the monomeric unit of protein. There are 20 amino acids having basic common…
Please input Shine-Dalgarno sequence also
Step by step
Solved in 3 steps
- Z-DNA derives its name from the zig-zag conformation of phosphate groups. What features of the DNA molecule allow this structure to form?The enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure of this modified nucleotide.true or false: Hydrophobic interactions between bases are the primary stabilizing forces responsible for maintaining the DNA double helix.
- A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?The purine and pyrimidine rings are built from the amino acids aspartate,glutamine, and glycine. Why is serine required for the synthesis of deoxyribonucleotides?The effect of base-pair substitution mutations on protein function varies widely from no detectable effect to the complete loss of a protein function. Why the functional consequences of base-pair substitution vary so widely?
- Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?The infectious prion protein which are believed to cause a neurodegenerative disease by acting as a template to misfold other cellular prion proteins are usually β-helices. Is this correct or not?The formation of a double-stranded structure must obey the rule that adenine hydrogen bonds to thymine (or uracil in RNA) and cytosine hydrogen bonds to guanine. Discuss reasons why complementarity is an important feature of DNA and RNA structure and function.