A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?

A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA…

A: Cystic fibrosis is a hereditary disease, inherited in an autosomal recessive manner. The cystic…

Q: A small section of bacterial DNA antisense strand has the following nucleotide sequence: GCC CAC…

A: An Antisense DNA strand directed in 5’ to 3’ end is the non-coding DNA strand of a cell which acts…

Q: Why is the double-helical structure of DNA stabilized at moderate to high ionic strength?

A: Ionic strength defines the high concentration of ions in the solution that are produced due to the…

Q: To maintain uniform diameter of the DNA double helix, only purines base with each other via two…

A: DNA is the fundamental structure that carries all the information of a living thing. In most cases,…

Q: For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the…

A: The complexity of an organism is based on the functioning of its genome. Deoxyribonucleic acid (DNA)…

Q: You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To…

A: In PCR, forward and reverse primers are to be added. PCR involves denaturation, annealing and…

Q: Why are most DNA-binding proteins specific to certain chemicalgroups within the DNA?

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: List three important structural motifs in DNA-binding proteins

A: Transcription is the process in which the production of mRNA from one of the strands of DNA, with…

Q: Give the complimentary DNA strand for the following: ACG TAG CTA GTC AGT CGT AGC Give the RNA…

A: NOTE:- Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and…

A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…

Q: Please by using the first base of each as the first triplet in a condo, how do I translate two…

A: Translation Translation is the process in which the mRNA or messenger RNA is get translated. mRNA of…

Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: When a segment of DNA containing either aVNTR or an RFLP is analyzed, the result is fragments of DNA…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Where would you expect DNA-binding proteins to bind if they recognize a specific base sequence? What…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that transfers genetic information from one…

Q: Using the straight-chain sugar convention where the vertical lines represent sugars and the…

A: DNA is the genetic material in all living organisms and it is made up of thymine, adenine, guanine,…

Q: Of the following DNA sequences which would you expect to have the highest melting temperature in its…

A: Melting temperature is defined as the temperature at which a double-stranded DNA molecule will break…

Q: Assuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides…

A: The process in which the messenger ribonucleic acid (mRNA) molecule sequence is translated to form…

Q: A closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a…

A: B-DNA IS BIOLOGICALLY THE MOST COMMON –RIGHT-HANDED (20 ANGSTROM (A) DIAMETER) –COMPLEMENTARY…

Q: Agarose gels with different average pore sizes areneeded to separate DNA molecules of different…

A: Gel electrophoresis is a procedure used in molecular biology that is used for separation of…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Discuss the role of the hydrophobic interactions in stabilizing the following. Q.) Double-stranded…

A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…

Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…

A: The hydrolysis is targetting the 3' Carbon of the sugar in the phosphodiester bond. 1st strand…

Q: The base analog 5-bromouracil (5BU), which sterically resembles thymine, more readily undergoes…

A: Base analogs are the purines and pyrimidines that are similar in structure to the normal DNA bases.…

Q: Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?

A: Introduction : Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are probably the most…

Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…

A: Double-stranded DNA consists of two polynucleotide chains each strand having a phosphodiester…

Q: Each of the following sequences has a total of 20 nucleotides (note that the first six are the same…

A: Introduction Stem-loop formation occurs in single-stranded RNA when two regions of the same strand…

Q: Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA…

A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Hemoglobin present in red blood cells helps in the transport of oxygen molecule to and from various…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature formula : Tm = 4* (G+C) + 2 * (A+T) Number of G+C = 6 Number of A+T = 20

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: You are characterizing a DNA-binding protein, and have used genetic experiments to identify a domain…

A: Proteins have a secondary structure which is 3D one and the two most common of these are the alpha…

Q: To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3',…

A: DNA: RNA hybrid are the structures that are formed between the newly synthesized RNA and the dsDNA.…

Q: which of the following sequences would most likely be able to bind a cyclic amp dna binding protein?…

A: Introduction: Nucleotides are the nitrogenous base, a pentose sugar and phosphate group. Nucleotides…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…

Q: Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it…

A: A heritable genetic change in the genetic material of an organism that gives rise to alternate…

Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…

A: Here in question, I believe “a” side in Phosphodiester bond refer to the side bond to 3’-C atom of…

Q: Which of the following sequences would most likely be able to bind a Cyclic AMP DNA binding protein?…

A: Cyclic AMP or cAMP is one of the most important secondary messenger prevalent in biochemical signal…

Q: In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleotide…

A: DNA sequencing: It is the biochemical method used to determine the sequence of the nucleotide bases…

Q: If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the…

A: The DNA is transcribed into the RNA by the process of transcription and translation is the process…

Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…

A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…

Q: Which of the following RNA sequences is an inverted repeat and can form a stem-loop structure?…

A: A single-stranded nucleotide sequence followed by its reverse complement at the downstream is called…

Q: Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA…

A: Mutations can be the change in the sequence of DNA and RNA, and mutations can be caused by a…

Q: Which of the following DNA strands (oligonucleotides) would have a higher melting temperature?…

A: DNA is a double helical molecule which is found in the cells of living organisms. The two strands…

Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…

A: DNA fragments – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…

A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…

Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…

A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…

Q: How often, on average, would you expect a restriction endonuclease to cut a DNA molecule if the…

A: Restriction endonucleases are enzymes that function like molecular scissors. They cut the…

Question

A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) is
constructed, will its melting temperature be higher or lower?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

How many kilobases of the DNA strand below will code for the protein product?
State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
A closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a high salt solution, the segment undergoes a transition from the B conformation to the Z conformation. What is the change in its linking number, writhing number, and twist?
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
which of the following sequences would most likely be able to bind a cyclic amp dna binding protein? (only one strand is shown but assume dna is double stranded) a. 5' atagtcatagtc 3' b. 5' atcggtctcgat 3' c. 5' gctctagcgagc 3' d. 5' atagtaatgata 3'
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?
The formation of a double-stranded structure must obey the rule that adenine hydrogen bonds to thymine (or uracil in RNA) and cytosine hydrogen bonds to guanine. Discuss reasons why complementarity is an important feature of DNA and RNA structure and function.
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?