. WHAT IF? Suppose a cell’s membrane potential shiftsfrom -70 mV to -50 mV. What changes in the cell’spermeability to K+or Na+could cause such a shift?

Q: The response of ligand gated ion channels is transient because ___ (can choose more than one…

A: The cellular response is initiated when a ligand binds to its specific receptors. The binding of…

Q: WHAT IF? If you exposed a cell to a ligand that bindsto a receptor and activates phospholipase C,…

A: Cells have proteins called as receptors that bind to the signaling molecules and initiate a…

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a…

A: Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: • Describe the concept of transport maximum (Tm). • Explain the membrane potential and the…

A: The term cell membrane or plasma membrane is associated with a protective layer enveloping the…

Q: Ligand binding of a (????) causes conformational changes in the receptor that free the associated…

A: A ligand is a molecule that binds to another molecule and, in some situations, sends a signal as a…

Q: 37.Given an intracellular concentration of 120mM and an extracellular concentration of 15mM,…

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: Vm mV Or -10 -2아 -30- -40 50 -60 10min OUABAIN

A: Introduction Ouabain is a toxic plant extract that acts as a cardiac glycoside that blocks the…

Q: Suppose calcium ion is maintained within an organelle at a concentration1000 times greater than…

A: If a voltmeter is attached to the two  sides of the cell membrane( inside and outside), then voltage…

Q: 3 An electrode was placed on a neuron and the voltage across the membrane was measured as the neuron…

A: The neurons are the nerve impulse generating and transmitting cells in our nervous system which have…

Q: From what you have learned in Biology, why is membrane potential essential among plants and animals?

A: Membrane potential is the potential gradient which is created due to difference in electric…

Q: Calculate the energy required for, or released in, a transport of 20 Na+ ions and of 100 molecules…

A: For a uncharged species, only its chemical potential gradient (i.e. concentration gradient) across…

Q: Explain neurons as a specialized form of cell signalling that acts long-distance, rapidly, and on…

A: specialised mechanism of cell signalling in neurons When a transmitting neuron fires, an electrical…

Q: MAKE CONNECTIONSPDGF signals cells by binding toa cell-surface receptor tyrosinekinase. If you added…

A: Receptor tyrosine kinases (RTKs) are cell surface receptors that are dimers. they have a…

Q: A hypothetical anion has a Nernst potential of -100 mV. At resting membrane potential (-70 mV), the…

A: The Nernst potential, also known as the reversal potential of an ion, is the potential difference of…

Q: WHAT IF? If you were a pharmaceutical researcher, whywould you want to learn the three-dimensional…

A: Pharmaceutical researchers want to try to treat diseases by learning how to change signalling…

Q: If the Cl- concentration outside of cells is 10 mM and inside of cells is 10mM, what would the Cl-…

A: In biology, the membrane has a reversal potential or equilibrium potential which possess the ability…

Q: Which of the following is not true in ligand-gated ion channels? a. S4 segment moves in response…

A: Protein channel receptor complex with a binding site for a small molecule. They open their…

Q: WHAT IF? Some membrane proteins diffuse faster in the plasma membrane when the cytoskeleton or the…

A: Cell membranes:  Thr diffusion across cell membranes uses integral membrane proteins to move polar…

Q: WHAT IF? If all the Ca2+in the fluidsurrounding a neuron were removed,how would this affect the…

A: Calcium ions are a universal second messenger that regulates the most important activities of all…

Q: ype Il diabetes response in cells to exercise is to increase the numbers of glucose transporters…

A: The endocrine system collaborates with the neurological system to keep the body in a state of…

Q: Which of the following could not be a heteromeric ion channel?

A: Channels are involved in passive transport. In passive transport, ions goes from high concentration…

Q: + + + +, 212 LOGY - BIt | + + + Given the information provided in this question, if 212 is an anion…

A: The cell's interior is usually negative at resting membrane potential. This membrane potential is…

Q: 3. For a typical mammalian cell, match the changes in the left column with the appropriate answer.…

A: Question - 3. For a typical mammalian cell, match the changes in the left column with the…

Q: describe the steps of a Local Potential, what channels open? what happens to the membrane potential?

A: Short-range change in voltage is known as Local Potential. Ligand-gates are present on the soma an…

Q: Calculate the maximum ratio that can be achieved by the plasma membrane Na+-glucose symporter of an…

A: The greater the permeability of the plasma membrane for a given ion, the greater will be the…

Q: WHAT IF? Ouabain, a plant substance used in some cultures topoison hunting arrows, disables the…

A: Ouabain is a cardiac glycoside. In lower doses, it can be used to treat hypotension and some…

Q: MAKE CONNECTIONS Explain why the set of forces driving ionmovement across the plasma membrane of a…

A: The spontaneous movement of molecules from the area of its high concentration to the area of its low…

Q: How is the cell membrane like a battery?

A: Cell membrane forms the outer most part of animal cells. It also limits the entry and exit of…

Q: An analog of cGMP, 8-Br-cGMP, will permeate cellular membranes, is only slowly degraded by a rod…

A: CGMP opens cation-selective channels when applied to the cytoplasmic side of excised patches of…

Q: If the K+ channels are blocked by TEA, which direction does the equilibrium potential for K+ move?…

A: K+ channels are layer proteins that permit quick and particular stream of K+ particles over the cell…

Q: What is the effect of membrane potentials on the movement of ions across a cell? use the following…

A: Answer: MEMBRANE POTENTIAL - It is basically the difference in electric potential between the…

Q: Vm Net flow of the Potassium Net flow of the Sodium -90 -70 +80 +64

A: Membrane potential, also known as transmembrane potential or membrane voltage, refers to the…

Q: Intestinal epithelial cells pump glucose into the cell against its concentration gradient using the…

A: Enthalpy and entropy are combined to form the Gibbs free energy. The combination of the system's…

Q: Which of the following would have the lowest (most negative) standard reduction potential (E’0)?…

A:

Q: A cell has an actual membrane potential (Em) at rest of -75mV. The equilibrium potential for Na+ is…

A: The force that acts on the ion of interest, causing the total movement of the ions across the cell…

Q: What is Anchorage Dependence? Describe the different Cell Junctions in Animal cells. What is the…

A: Hey, since there are multiple questions posted, we will answer first question. If you want any…

Q: Which of the following does not influence (i.e has no impact on) the value of the Nernst potential…

A: Neurons transmit nerve impulses as chemical signals called neurotransmitters or electrical impulses…

Q: at rest, a cell has a negative charge inside the plasma membrane and a positive charge outside the…

A: Introduction Animal cell is surrounded by a plasma membrane. Plasma membrane is a selectively…

Q: WHAT IF? What would happen if a mutationin protein kinase 2 made it incapable of…

A: Phosphorylation of protein is of utmost importance in cellular regulatory mechanisms as a variety of…

Q: WHAT IF? If two cells have different scaffolding proteins,explain how they might behave differently…

A: Scaffold proteins are modular proteins that assemble multimolecular complexes or macromolecular…

Q: WHAT IF? Some human diseases are associated withmalfunctioning protein phosphatases. How would…

A: Protein phosphatases are the enzymes that are involved in removing phosphate group from the…

Q: At Intestinal epithelial cells pump glucose into the cell against its concentration gradient using…

A: Two questions are asked. I am allowed to answer only 1st question, as per guidelines.  Given : Na+…

Q: WHAT IF? Suppose a mutation caused gated sodiumchannels to remain inactivated longer after an…

A: Movement of Na+ and K+ ions across the membrane generate the action potential, that conduct the…

Q: MAKE CONNECTIONS Is the flow of ions through a ligand-gated channelan example of active or passive…

A: All the cells have a membrane surrounding their organelles which allow support, protection and…

Q: Intestinal epithelial cells pump glucose into the cell against its concentration gradient using the…

A: Using the given information, Energy released by downhill movement of sodium ions,  Delta G =…

Q: WHAT IF? If a Paramecium swims from a hypotonicto an isotonic environment, will its contractile…

A: Tonicity can be defined as the ability of an extracellular solution to cause a cell to gain or lose…

Q: Estimate the equilibrium potential of a cell at 37 °C if the concentration of K ions inside the cell…

A: The voltage differential across the cell membrane at rest (no signaling) is referred to as resting…

Q: On a neuron, where is it unlikely for voltage activated potassium channels, sodium channels or…

A: Neurons are messengers of information. They transmit information between different areas of the…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.