0.9% NaCl sol osmosis po

Q: Draw the cladogram for "organisms" A-J of the family "Boltidae". Include each of these letters and…

A: Cladogram is a branching diagram which show the cladistic relationship between a number of organisms…

Q: can you discuss the role of alternate medicine and holistic approaches to health in the current…

A: Introduction Alternative medicine is any practice that aims to attain the healing effects of…

Q: A nonsense mutation is a mutation that creates a premature stop codon in the protein sequence. Based…

A: A nonsense mutation is a mutation that creates a premature stop codon in the protein sequence.

Q: A phage that reproduces slowly, produces relatively few phage particles, and only undergoes the…

A:

Q: Under the fluorescence microscope, what is the structured stained in red? O centrioles O sister…

A: Fluorescence microscopy is a technique that is based on using Fluorescence to observe specimens.…

Q: We compared the speed of transduction of the taste of sour vs either sweet or bitter, depending on…

A: A taste receptor is a type of cellular receptor found in the taste buds of papillae. When a food…

Q: if 20 skin cells enter G2 phase, how many cells will be observed at the end of metaphase? O 10 030 O…

A: The orderly sequence of events by which a cell duplicates its DNA synthesizes its other components…

Q: Explain in a brief paragraph how is DNA released during extraction.

A: DNA extraction is a routine procedure used to isolate DNA from the nucleus of cells.

Q: A student develops four models for the composition of a eukaryotic cell. The weight of the cell is…

A: Introduction There are two types of cells are found depending on the presence of true nucleus.,…

Q: What are the primary nutrients and how are they metabolized by cells?

A: Introduction  Our food comprises three primary nutrients: carbohydrates, proteins, and fats. These…

Q: The total body fluid is composed of the following: O a. Intracellular Fluid (ICF) O b. Blood Oc.…

A: Body fluids are those natural fluids present in the body through which the substances necessary for…

Q: Under what conditions when the Renkin-Crone equation can be applied? Why? Give an example situation…

A: Renkin-crone  Equation :       The renkin- crone equation shows that the transport from the blood in…

Q: How can primary and secondary endocrine disorders be differentiated?

A: Introduction Hormones are chemical compounds crucial for life. Chemically they can be either…

Q: The Mayor of the City is best compared to which part of the cell?*       Nuclear Envelope…

A: Cell is the basic structural and functional unit of life. Organelles present in the cell are like…

Q: Our skin is the largest organ of our body. It belongs to integumentary system. Our skin is made up…

A: Introduction Skin is the largest organ of the body, which is composed of water, protein, lipids, and…

Q: List down the signs of successful pithing.

A: Introduction   When an animal has been rendered unconscious by another method, pithing may be…

Q: What causes regular cocaine users to chose that "initial high"?

A: Cocaine, a highly addictive stimulant narcotic, is derived from the leaves of the South American…

Q: Animal Life Cycle Plant Life Cycle Zygote Zygote Diploid adult Diploid adult Spores Gametes Haploid…

A: The number of whole sets of chromosomes that make up a cell is known as its ploidy. Their paternal…

Q: ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAAT…

A: The simplest definition of gene expression is the production of the gene's complementary protein,…

Q: Which of these groups is characteristic of thiols? B O A OD OC -В -D E

A: Thiol  It is a functional group of sulphur and hydrogen atoms (—SH).

Q: You are designing a medical device to collect Carcinoembryonic Antigen (CEA, MW = 180,000 g mol^-1),…

A: Explanation: The mass transfer coefficient is a measure of the rate of transfer of a substance from…

Q: if 20 skin cells enter G2 phase, how many cells will be observed at the end of metaphase' 20 030 040…

A: A cell cycle involves series of events that aids a cell to replicate its genome, generate new cell…

Q: What is phase contrast? Give examples of phase contrast in optical microscopy

A: Microscopy is the technique for visualisation of ultra-small objects such as cells or even smaller…

Q: A) Consider membrane filtration. What is concentration polarization and why does it occur? B) What…

A: A) Consider membrane filtration. What is concentration polarization and why does it occur? B) What…

Q: he structure of a mutated coronavirus strain found in the Philippines needs to be etermined. he…

A: Qualitative analysis is done by analysing and checking the quality of the specimen or the sample…

Q: Which characteristic of water makes it a universal solvent? A. O weak bonds B.O polarity G.O…

A: Introduction Almost 75% of the human body is composed of water. About 70% of the earth's surface…

Q: Explain why it makes sense for the PDH complex in liver to be active when dephosphorylated.

A: Pyruvate Dehydrogenase Complex(PDH) is a multienzyme complex that is involved in pyruvate…

Q: Fossil fuels are a sink for carbon located in the   a. hydrosphere.   b. lithosphere..   c.…

A: Fossil fuels  They are the prehistoric dead plant and animal which is made up of hydrogen and…

Q: ree groups of plants are grown in the same location in a greenhouse, each receiving the ame amount…

A: An experiment is a scientific investigation in which  a point is proved by giving a certain…

Q: Question: 8. What does it indicated if the foramen magnum is located near the rear of a skull? It…

A: Foramen Magnum is a hole in the skull where the spinal cord is located.

Q: 1. An experimental study is conducted to determine whether a new drug reduces high blood pressure.…

A: In the context of research study a variable is defined as any feature with the potential to change,…

Q: In which stage of the cell cycle do cells grow and accumulate all necessary molecules in preparation…

A: Cell division is a phenomenon in which parent cell splits off and gives rise to novel cell . Number…

Q: After reading the scenario,fill in the table with the following information.

A: Scientific research methods involve following step-by-step procedures and approaches to research…

Q: Please write introduction paragraph on the topic about about human germline gene editing using…

A: Successful somatic and germline genome editing is becoming possible thanks to CRISPR/Cas9 and other…

Q: 3. Enzymes are important during the process of fertilization. What would be the anticipated…

A: Introduction :  Sperms are the male gametes. It is produced in the testes. Sperm is the male…

Q: 2. Antibiotics a. Candida albicans is a eukaryotic yeast that can cause thrush and vaginal yeast…

A: Candida albicans is a normal part of the human commensal flora, however it is also the most common…

Q: 3. What are the specialized parts found in plant cells?

A: The second question is based on experiment so can't be answered.  We are allowed to do up to one…

Q: "Tobacco smoking triggers a large number of somaticmutations and epigenetic changes". Define about…

A: Mutations are any change in the DNA sequence of a gene that is coding for a specific protein in a…

Q: Sudupe

A: Chromosomes are the condensed form of nucleic acid. The chromosomes are formed during the cell…

Q: 4. Into what cavity does the blastopore open? The gastrular slit? What becomes of each? 5. Explain…

A: Introduction :  The initial gut that develops during the gastrula stage is called the archenteron.…

Q: The tickle response can also trigger escape movements, increased heart rate and tears. What type of…

A: Introduction  The neuron, a specialised cell created to send information to other nerve cells,…

Q: A patient came to the clinic with a complaint of malaise. She said she’s been feeling week since the…

A: Introduction  Anemia is a disorder in which there are insufficient healthy red blood cells to…

Q: A few finches from the mainland get caught in a strong wind and end up colonizing a new island.…

A: Hardy Weinberg (HWE) principle – In HWE the genotype frequencies and allele frequencies of a…

Q: 14. Matching. Write the letter corresponding to the correct answer next to the description. A.…

A: The leaves of green plants have different types of cells specialized to perform different functions.…

Q: You expect that a lung tumor cell line has arisen due to aberrant expression of the growth factor…

A: Cancer is due to the uncontrolled proliferation of the cell. This uncontrolled proliferation is…

Q: Because a plaque can arise from many phage particles, the number of plaques on a plate does not…

A: Phage is a bacteriophage that infects a bacterium. It has two phases a lysogenic phase and a lytic…

Q: Labelling the parts of a frog's ovary

A: Reproduction can serve two distinct purposes. The two distinct purposes of reproduction are…

Q: The following is present inside of the cell O a Intracellular Fluid (ICF) Ob. Blood OC Interstitial…

A: The cell was discovered by Robert Hook in 1665. Cell is very important and basic unit of life, as it…

Q: What does translucent spot mean with regards to lipid?

A: Fats and lipids are important biomolecules. These are high-energy molecules. Fats and lipids are…

Q: What are Differentiated cells ?

A: All living beings are composed of one or more cells.