1. As DNA engages in semi-conservative replication, explain what the following enzymes roles are in this process. ✓✓✓✓ DNA Polymerase II: DNA Helicase: DNA Ligase:

Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…

A: A diagrammatic representation of biological entities related via common descent, like species or…

Q: What is one of the determining factors in the three-dimensional structure of a protein?   A.The…

A: Introduction:- There are different types of bio-macromolecules and bio-micromolecules present in…

Q: Palivizumab is a humanized monoclonal anitbody for the prohylaxis of resporatory diseases caused by…

A: Palivizumab is a humanized monoclonal anitbody developed to help protect against respiratory…

Q: 1. Following Glycolysis, the second stage of cellular respiration is the Krebs (or citric acid)…

A: The Krebs cycle or TCA cycle or tricarboxylic acid cycle or Citric acid cycle is a series of enzyme…

Q: _______ is the net movement of substances from a high concentration to a low concentration medium,…

A: Introduction: Diffusion is the overall net movement of anything from a higher concentration to a…

Q: When a disease is transmitted by an insect, touching an inanimate object or through aerosols it is…

A: Answer: Transmission of disease : It is the process of transferring or transmitting infection or…

Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…

A: The research contributes to a better knowledge of illnesses and other health issues, such as their…

Q: mechanics of breathing

A: Breathing: It is defined as the process where atmospheric O2 is exchanged with CO2 which is…

Q: 6. Why is DNA replication considered to be semiconservative? a. Each original DNA strands makes a…

A: DNA replication is a process where a double-stranded DNA molecule is copied to produce two identical…

Q: a) What phenotype are the parental strains? FFss b) What is the phenotype and genotype of the F1's?…

A: The genotype is the genetic constitution of an individual for any particular trait. whereas the…

Q: Compare and contrast the 2 systems that your body uses to coordinate the activity of body cells.…

A: The two important systems of the body that coordinate activity are the nervous system and the…

Q: The results of this study provided opportunities for further research.  What may be a hypothesis…

A: Insect migration success is dependent on temperature Insect population numbers are affected by land…

Q: Deoxyribose sugar Thymine Guanine Phosphate Hydrogen bonds [Choose] [Choose [Choose ] [Choose ]…

A: DNA It is Deoxyribose Nucleic acid.  It constitutes two polynucleotide chains that wound around each…

Q: Discuss the various definition of  morphology. 2.What is your own definition of morphology?

A: We can classify and identify different organisms in different aspects.We can classify them using…

Q: Differential RNA splicing may result in: a. A shift in the ratio of mRNA produced from two…

A: The process of removing the introns from the immature RNA and ligating the exons is known as RNA…

Q: Why are defects in DNA repair often associated with cancer?

A: Cancer is mainly a genetical disease.It can directly affect DNA of our cells.Now to form a cancer…

Q: 5. a) Describe, using a diagram or point form notes, what is happening during transcription and…

A: Transcription is the process of copying genetic information from one strand of the DNA into RNA.…

Q: 1. CHOOSE THE BEST ANSWER: 1. Which among the following is NOT a function of the urinary system? A.…

A: The excretory system is a passively biological mechanism that eliminates extraneous substances from…

Q: 1.  Do you think it is important to understand evolution?  List three different ways that evolution…

A: The concept of evolution was given by two scientists Darwin and Wallace. It was based on natural…

Q: Which of the following is a high through put DNA sequencing method that involves distribution c DNA…

A: Identifying the sequence of nucleotides, or bases, in a DNA molecule is referred to as DNA…

Q: Curator makes a goo (c) Calculate the enthalpy of combustion for ethanol using bond energies and…

A: Burning some materials at high temperatures is referred to as combustion. A gaseous material (smoke)…

Q: How does CO2 get into the tree and how does O2 get out of the tree? Which part of the plant is…

A: The exchange of gases is crucial for the survival of all living things. Living organisms require…

Q: Micorgnathozoans are characterized by (check all that apply) - dorsal plates -…

A: A class of tiny marine organisms known as Micrognathozoa often measure less than 1 millimeter in…

Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…

A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…

Q: Which of these describes the symptoms of the disease(s) caused by mutations in KMT2D ? Select all…

A: For a protein participating in a critical biological activity, such as DNA synthesis or cell…

Q: Color blindness is a recessive trait on the X chromosome. What are the genotype and phenotype ratios…

A:

Q: What is a protozoan cyst? Discuss the importance of this structure in the ability of Giardia to…

A: Introduction:- Protozoa are one celled animals found worldwide in most habitats. They are…

Q: Which of the following are reproductive organs? Select all that apply  A. Root B. Leaf C. Stem…

A: In plants, which organs are directly responsible for sexual reproduction, or take part in sexual…

Q: List examples of the synthetic, metabolic, and excretory functions of the kidney

A: Understanding the functioning of the body's systems is essential for several reasons. By…

Q: If the ocular lens is 10x, what would be the total magnification for the following objectives…

A: A microscope consists of two types of lenses, the low power lens is called the ocular lens also…

Q: What is the most common portal of entry?   Question 12 options:   a)  food & water   b)  mucous…

A: E. Respiratory aerosols

Q: 1 67 почуття

A:

Q: attempt to evolve cold-tolerant winter

A:

Q: a) What molecule is released after the nucleotides are linked via a phosphodiester bond? b) What do…

A: DNA (Deoxyribonucleic acid) is the genetic material in most of the organisms. It is a double…

Q: Disruption of homeostasis can lead to __________ and ___________. __________ is a general term for…

A: Disease:  A disease is a specific aberrant state that adversely affects an organism's structure or…

Q: Considering both habitat conditions and requirements for successful symbiosis, why should you be…

A: The question is asking about the potential similarities in the microbial symbiots found in two very…

Q: Any break in the chain of infection prevents the spread of disease.   Question 4 options:   a)…

A: True.

Q: peptide bond Primary Structure Secondary Structure Tertiary Structure NH3+ Quatern Structur 2. Using…

A: Amino acids  sequences linked together by peptide bonds form the primary structure of a protein. Any…

Q: Hypothesis Generation and Experimental Design Green sea turtles spend most of their lives in the…

A: The various research and experiments are conducted by studying the relationship between the two…

Q: 5. Which of the following is considered acellular? Aspergillus fumigatus Mycobacterium tuberculosis…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: B. Write the function/s of each part of the microscope listed below. a. Eyepiece b. Draw tube c.…

A: An instrument,  microscope is used to observe tiny objects even cells. It examines the objects that…

Q: In a clinical trial it might seem unethical to compare a drug candidate versus a placebo rather than…

A: The term “Placebo” refers to a substance that is manufactured to have no therapeutic value. For…

Q: HO ↑ A CH3 B choline head group H3C. C glycerol backbone CH3 CH3 < CH3 B- CH3- CH3 C-CH₂-CH O O C 0…

A: A= Sterol group  B= Choline C = Glycerol D = Acyl chain

Q: should be minimum one paragraph explaining statement Groups of organs with specific structures and…

A: An organ is a structure made up of different types of tissue that performs a specific function or…

Q: Describe what a pseudogene is and what impact they have on gene expression

A: A pseudogene is a nonfunctional gene that can be compared to junk DNA.

Q: Describe the specificity of glucose oxidase. Compare it with the three other methods.

A: A specific enzyme called glucose oxidase catalyses the oxidation of glucose in the presence of…

Q: What characteristics does a lizard have to adapt to desert wind and dust storms? For example what…

A: Reptiles and amphibians can live in desert environments without suffering from extremities of…

Q: Carbohydrates are classified by The most common simple sugars are glucose, galactose and fructose…

A: Introduction:- Biomolecules are the carbon containing organic compounds, present in the living…

Q: This is for an immunology class   1. Name of a type of host defense mechanism 2. One of the types…

A: Introduction: Immune system: an intricate system of organs, tissues, and the substances they produce…

Q: Explain the steps of RNA translation into protein.

A: “Since you have posted multiple questions, we will provide the solutiononly to the first question as…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.