1. how to isolate 26s rRNA from water, surface of water and kelps surface 2. what is the PCR tool to use for 26s rRNA. 3. what is the background of the title: metabarcoding of yeast communities associated with kelp beds in marine ecosystem
Q: D A mutation in the Pitx1 gene prevents normal hindlimb formation in mouse embryos. Analyses of the…
A: Mutations are changes that occur in the DNA sequence of an organism's genome. They can be caused by…
Q: The muscle contractions required to maintain balance and posture while moving would be considered: O…
A: Muscular system is a body system which is involved in regular contraction and relaxation so as to…
Q: Saltatory conduction occurs on? Dendrites Cell bodies Unmyelinated axons…
A: Saltatory conduction is a type of nerve impulse conduction that occurs in myelinated axons, where…
Q: Suppose 0.240 gram of the green salt is weighed out for this experiment. What is the mass percentage…
A: The green salt which has Fe and is most commonly used in titration is Mohr's salt so we are…
Q: Each type of pre-mRNA processing has one or more important functions. Match each function with the…
A: The addition of a 5' cap to pre-mRNA has several important functions: Facilitating transport of…
Q: 1) What is the main reaction that causes monomers to build into larger molecules? (Spelling counts!)…
A: Introduction Macromolecules are large molecules that are composed of smaller building blocks called…
Q: How many sets of chromosomes does the pollen of an gymnosperm have?
A: Conifers and cycads and ginkgoes are examples of gymnosperms, which are seed bearing plants. They…
Q: Curare is a paralytic toxin once used by indigenous South American tribes to hunt game. The toxin…
A: Inhibiting acetylcholinesterase at the neuromuscular junction and Blocking reuptake of acetylcholine…
Q: Those phenotypes that are controlled by factors found in the cytoplasm of the female ovum are said…
A: Eukaryotic genome consist of nuclear genome and extra-nuclear or cytoplasmic genome ( mitochondria/…
Q: INTRODUCTION: Quadrat sampling is a classic tool for the study of ecology, especially biodiversity.…
A: Quadrat sampling: Quadrat sampling is a method of sampling biodiversity in which a plot of a fixed…
Q: Following a mutagenesis experiment to identify novel genes affecting the circadian clock in…
A: Based on the given information, we know that the c and d mutations are recessive, and that both the…
Q: You may want to have your macromolecules/biomolecules packet to help with this question. The image…
A: Enzymes are too specific, meaning that they can as they were catalyze particular responses, which…
Q: Which of the following is NOT true about infectious mononucleosis ("mono")? None of the other four…
A: Infectious mononucleosis is Caused by Epstein-Barr Virus, a type of herpesvirus: The Epstein-Barr…
Q: Why is penicillin toxic to bacteria but not to higher organism? Explain briefly
A: Penicillin is an antibiotic drug that was discovered in 1928 by Alexander Fleming, a Scottish…
Q: How does the kidney maintain the body's internal environment?
A: The kidney plays a crucial role in maintaining the body's internal environment, also known as…
Q: ab questions (due at the start of the You will examine four different phyla this week. Which of…
A: Acoelomates-An acoelomate is an animal that does not possess a body cavity or coelom.…
Q: different types of test that doctors preform to diagnois the disease. my question is, is there a…
A: Coronary artery disease is a condition in which the arteries supplying blood to the heart narrow or…
Q: 3. The cell growth in problem 1 is now transitioned to a 12.0 L continuously-stirred tank reactor (a…
A: Cells grow during a continuous bioreactor under continual feed supply and waste removal conditions.…
Q: How does lambda excise and replicate during the lytic cycle? Explain the factors that determine…
A: Lambda may be a mild bacteriophage that can coordinate its genome into the genome of the host…
Q: For the central nervous systems explain the functions and where relevant their relationships of the…
A: The Central Nervous System (CNS) is the most important unit in an organism as it is the ‘center’ or…
Q: Frank has shown symptoms of Korsakoff’s syndrome for the past ten years. Frank is LEAST likely to…
A: Korsakoff's syndrome is a type of amnesia that often affects long-term memory. People with this…
Q: Which process does NOT happen in the small intestine during lipid digestion? a. secretion of bile…
A: Answer 4: d. a, b, and c are the correct Answer 5: a. It hydrolyzes the bond between the fatty…
Q: In detail, explain the difference between Hodgkin's Lymphoma and non-Hodgkin's Lymphoma.
A: Introduction :- Hodgkin's lymphoma (HL) and non-Hodgkin's lymphoma (NHL) are both types of cancer…
Q: Different mechanisms create different types of chromosomal aberrations; for example, nondisjunction…
A: Introduction: Meiosis is a type of cell division that occurs in sexually reproducing organisms to…
Q: Give typing answer with explanation and conclusion 1) What is the purpose of the CD4 and CD8…
A: CD4 and CD8 are cell surface proteins found on T cells in the immune system. CD4 is primarily found…
Q: Which of the following is termed as conserved gene order? a) Microarray b) Ortholog c) Synteny d)…
A: A gene is a segment of DNA (deoxyribonucleic acid) that carries the hereditary information of an…
Q: The equilibrium constant for the chemical equation N2(g)+3H2(g) - - -2NH3(g) is Kp=0.0357 at 203 °C.…
A: In the given equation, there are 4 molecules of reactant (1 N2 + 3 H2) and 2 molecules of product (2…
Q: What mechanisms does the phagolysosome use to kill the thing that was brought into the cell?
A: Introduction The immune response is a complex biological process by which the body's immune system…
Q: Sheep and cow manure are used as inorganic fertilizers by farmers and gardeners.
A: Manure is the biodegradable fertilizer produced by the decomposition of plant and animal waste or…
Q: 4. Analyzing: A. Analyze the pedigree below and determine if the trait is inherited as autosomal…
A: The type of inheritance pattern shown in the above pedigree is X-linked recessive. It is x-linked…
Q: Mycorrhiza – What is mycorrhiza? Describe the differences between the two main categories…
A: Introduction Fungi are a diverse group of organisms that are found in almost every ecosystem on…
Q: Expiratory Reserve Volume + Residual Volume = Multiple Choice Capacity.
A: Vital capacity (VC) is the maximum amount of air that a person can forcefully exhale after taking a…
Q: b. A hamster has a heart rate of about 634 beats per minute. About how long will a hamster live?
A: The heart rate of hamster is 634 beats per minute. The life span and the heart rate of mammals are…
Q: Plants are living organisms that belong to the kingdom Plantae. They are multicellular eukaryotes,…
A: Introduction Plants are living organisms that belong to the kingdom Plantae. They are multicellular…
Q: Lane 1: A normal individual Lane 2: An individual homozygous for a deletion that removes the -50 to…
A: Northern blot, is a technique used to determine the genetic expression in the cells using RNA. It is…
Q: Are there any molecular factors affecting the drug darolutamide efficacy (i.e. mutations)?
A: Introduction Molecular factors refers to any molecular characteristics that influence the ability of…
Q: Explain the term "gender reassignment." Provide a description of the pros and cons of allowing this…
A: Gender reassignment is a surgical processor in which changes in the gender from birth gender to…
Q: A poultry grower has 2 breeds of chicken, averaging 9 and 5 lbs. In weight. The F1 of the cross…
A: When two different breeds of chicken are crossed, the F1 generation will typically have an…
Q: The allele "a" occurs with a frequency of 0.17 in a population of clams at Hardy- Weinberg…
A: Hardy Weinberg Equilibrium states the genetic equilibrium of the population. It is achieved when…
Q: RNA differs from DNA in that: All are correct ORNA contains ribose. RNA contains uracil ORNA is…
A: RNA stands for Ribonucleic acid. It is a type of nucleic acid that is found in all living cells. RNA…
Q: Is there any other existing gas that work in infection prevention (formaldehyde, ethylene oxide), if…
A: Infection is the invasion and multiplication of harmful microorganisms, such as bacteria, viruses,…
Q: Give typing answer with explanation and conclusion lets say, you treat a bacteria with an unknown…
A: When microbes are uncovered to antibiotics, "they learn how to resist them, which is known as…
Q: True or False: Omega 3 and omega 6 fatty acids can only be made by plants, though they can be…
A: Omega-3 and omega-6 fatty acids are essential polyunsaturated fatty acids that must be obtained…
Q: Gluconeogenesis is not a mere reversal of glycolysis, explain?
A: Gluconeogenesis and glycolysis both are metabolic pathways related to the metabolism of glucose and…
Q: In terms of cellular structure, what is the difference between plant and animal cell?
A: As we know all living entities have a basic structural and functional unit which is cell. There are…
Q: teven mixed 30 μL of cells with 150 μL of cell culture media, then transferred 10 μL to the…
A: A hemocytometer, also known as a counting chamber, is a laboratory device used to count cells or…
Q: Which of these organisms does NOT live in the human intestine? Select one: a.Acetobacter xylinum…
A: Introduction: A pathogen is a microorganism that can cause disease in a host organism, such as a…
Q: Give typed full explanation A drug has been developed that blocks complex 1 of the mitochondria…
A: The electron transport chain is a series of membrane-associated protein complexes located in the…
Q: A bacteriophage lytic development cycle is determined by the expression of its genes. How are these…
A: Bacteriophages are also known as phages, these are viruses that infect bacteria for the completion…
Q: What typical structure[s] is/are found in integral membrane proteins – how do they span the…
A: Introducion Cell membrane or plasma membrane separates the cell from outside environment. The plasma…
1. how to isolate 26s rRNA from water, surface of water and kelps surface
2. what is the PCR tool to use for 26s rRNA.
3. what is the background of the title: metabarcoding of yeast communities associated with kelp beds in marine ecosystem
Step by step
Solved in 2 steps
- 1. Briefly outline the components of the CRISPR/Cas system 2. What is the function of the CRISPR/Cas system? 3. What do you think about the ethical impacts of a technology such as CRISPR? 4. What is the main parameter that is used to define new virus families among archaeal viruses? 5.List and outline that various stages through which bacteria and archaea fight back against infection with viruses.16. Why was ribosomal RNA (rRNA) used to create the first phylogenetic tree? Group of answer choices rRNA is very stable and can survive for billions of years rRNA is found in high abundance in bacteria and eukaryotes but is absent from archaea rRNA sequences are the same in all organisms rRNA is found in all living things allowing it to be a barometer of evolution rRNA mutates rapidly making it a good tool for tracking the mutationsImagine that there is an E. coli outbreak in your area, and you would like to test the kangkong from your local grocery store. How could you modify this protocol to extract DNA from the kangkong (to identify the species) and check for presence or absence of E. coli.? Keep in mind that (i) E. coli is free-living and not an endosymbiont, and (ii) plant cells are encased in both a cell membrane and cell wall.
- ou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT a. mycobacterium b.some kind of fungus c. steptococcus species d.nocardiaWhat are the 4 characteristics/properties of rRNA genes which make them good molecular chronometers. Why viruses are not found in the tree of life? Why might viable cell cultures be of more use in microbial taxonomy than preserved specimens? Is it possible to provide a formal name for a microorganism that has not been cultivated in isolation? What kind of name might be used if a microorganism is well-characterized but cannot yet be cultivated in isolation?2. Their genomes properties and the characteristics of each group in the Baltimore classification. Please explain in detail s
- Genetic analysis of Mycobacterium leprae, the bacterium that causes leprosy, reveals that its genome has undergone decay over time, losing DNA and acquiring mutations that make some of its genes nonfunctional. What might be some potential reasons for this evolutionary decay of its genome?_________5. It is a eukaryotic cells that contains also plasmids and use to produce desirable proteins. A. Bacillus thuringiensis B. E. coli C. Saccharomycetes cerevisiaeDescribe briefly the perks, disadvantages and use of 16s rRNA genes in taxonomic level of classification of bacteria. Cite the claims to be discussed, only here: https://journals.asm.org/doi/full/10.1128/CMR.17.4.840-862.2004 Create a review format of the task.
- A) What module can we use to run BLAST over the internet in Biopython: Bio.Blast.NCBIWWW Bio.Blast.NCBIXML WWW NCBIXML B) Which one of the following modules is not part of the Bio.Blast package in Biopython: NCBIStandalone FastaIO ParseBlastTable NCBIXML 3. Question 3 Using Biopython find out what species the following unknown DNA sequenceBriefly discuss the following topics, including appropriate examples for each:3.1. Genomic fingerprinting for the phylogenetic analysis of bacteria 3.2. Photosynthetic pigments and environmental habitats of green sulphur bacteria3.3. Advantages of phage therapy for bacterial infectionsplease provide handwritten explanation 1 it is written tranlation and trancription occurs early in bacteria does that means in bacteria central dogma rule dosen't follow I am sending you two images
