1. Illustrate a brine floatation method. 2. What are the disadvantages and advantages in using a brine floatation method in fecal examination? 3. What are the things needed to consider in doing a brine floatation method? Answer 1,2,3

1. Illustrate a brine floatation method. 2. What are the disadvantages and advantages in using a brine floatation method in fecal examination? 3. What are the things needed to consider in doing a brine floatation method? Answer 1,2,3

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

Chapter12: Skin Medications

Section: Chapter Questions

Problem 5CRQ

See similar textbooks

Related questions

Q: What suggestions would you give for improving one’s immune system? Please explain the reasoning…

A: Immune system is very important for the proper functioning of body, without immune system our organs…

Q: How do proteases liberate bioactive peptides from various protein sources? Give different examples…

A: Proteases, also known as proteinases or proteolytic enzymes, are a large group of enzymes that…

Q: Why do anisogamous organisms only experience the twofold cost of sex?

A: Anisogamy is a kind of sexual reproduction that involves the fusion of two gametes that differ in…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: Indicate the average direction of change (increase, decrease, or no change) observed between 1850…

A: When there is long term change or shift in temperature or weather patterns , then it is called as…

Q: A distinguishing characteristic of Eukaryotes is that they contain membrane-enclosed organelles and…

A: The presence of a nucleus distinguishes eukaryotes from prokaryotes. Eukaryota is one of the three…

Q: Which of the following is an explanation for independent assortment of alleles on different…

A: ANSWER;- B) In metaphase I, the alignment of 1 pair of replicated chromosomes does not affect the…

Q: Instructions: The information must be based on real and credible scientific articles. Not from just…

A: Neisseria meningitidis: Neisseria meningitidis bacteria are responsible for causing meningococcal…

Q: Assuming that 32 million histone octamers arerequired to package the human genome, how many his-tone…

A: Introduction :- Chromosome proteins are a type of protein. Histones bind to DNA, aid in the…

Q: Match the plant parts with the best description. ___ vascular cambium a. ground tissue in…

A: There are different parts of plants that have distinct functions. These parts include seeds, leaves,…

Q: To determine: The hormone which is present in higher amounts in blind women and protects the from…

A: Cancer is a state or condition in which cells grow uncontrollably. Cancers come in a variety of…

Q: Operon X produces three enzymes that convert Compound A to Compound B. The R gene makes the…

A: Gene expression is given on the basis of RNA. It is a process through which there is turning on of…

Q: -In the kennedy class IV, II,I take the support from abutment and most prominent bone should have…

A: There are few important points that should kept in mind . Which are as follows: Applegate's rules…

Q: To explain: The impact on the phenotype of common wall cress (Arabidopsis thaliana) as a result of a…

A: Mutation is a permanent change in some nucleotide sequences in an organism's DNA that can cause…

Q: he propensity to develop retinal cancer can run in pedigrees of certain families. You have learned…

A: Tumor suppressor genes are important cancer prevention genes since a partial or total inactivation…

Q: If a piece of the template strand of DNA has the sequence 5’- ACG.ACC.GCC.GGT -3’ and it is…

A: Codon is a group of three bases in mRNA. Each codon specifies an amino acid.

Q: .Leifson's stain is made up of tannic acid, basic fuschin stain prepared in alcohol base .A .B F .c…

A: Leifson's stain is a method used to identify the infections of the Helicobacter pylori bacterium.…

Q: Describe the structure of the Lac operon. How is it turned on? How is it turned off?

A: The gene products of the lac operon are very important for lactose metabolism. This is crucial for…

Q: Compare the stem of a monocot, dicot, and woody dicot: Feature Monocot Herbaceous dicot Young woody…

A: Features monocot dicot Cortex present but not differentiated present and differentiated…

Q: Referring to the figure, what bases will be added to the primer as DNA replication proceeds? 5'[a]3'…

A: In a DNA molecule, the bases on the opposite strands are paired complementary to each other. A…

Q: 1. component of atmospheric air, is an oxygen diluent 2. correlated with other indicators of the…

A: Nitrogen exerts 78 percent of the pressure in a particular volume of air because it compensates 78…

Q: The end result of BOTH transcription and translation of the DNA sequence AAGCTGGGA would result in?…

A: The genetic material in most higher organisms and some viruses in DNA. It is composed of a sugar…

Q: 17 Match the number of the label in the diagram below with the appropriate site or structure from…

A: Electron transport chain Also called the ETC is composed of four protein complexes. These protein…

Q: Difference between plant and animal protein foods.

A: Protein is fount in plant as well as animal foods.

Q: In confocal microscopy, what is the theoretical resolving power of the objective used (63X, NA 1.3,…

A: Resolving power signifies the smallest distance between two separate points of an object, when…

Q: Which of the following are functions of the skeletal system? (select all that apply) a) mineral…

A: Introduction Skeletal System:- It is the foundation of your body, giving it structure and allowing…

Q: How would the slowest band from the HinDIII-digest of pGLO align with the the bands of the ladder?…

A: Plasmid It is usually circular extra chromosomal piece of DNA present in bacterias and some…

Q: You have been hired to produce a family tree for three generations of a family where a disorder…

A: The answer given in step 2

Q: Differentiate the reproductive structures and processes of the four plant representatives according…

A: There are four groups of land plants bryophyta, pteridophyta, gymnosperms and angiosperms. Out of…

Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…

A: A Cell is made up different molecules that help it in maintaining its structure and function.…

Q: explain how signalling molecules generate gradients of other signalling molecules that mediate the…

A: Gradient generated during embryonic development by signaling molecules.

Q: When guard cells swell,______ . a. transpiration ceases c. stomata open b. sugars enter phloem d.…

A: Introduction :- Guard cells are found in the epidermis of the leaf, and pairs of guard cells…

Q: Choose a situation on how an organism (plant/animal) maintains homeostasis.

A: Introduction :- Homeostasis is the tendency to maintain a stable, relatively consistent internal…

Q: Give an example of an industrial/clinical setting where quantifying viable bacteria would be useful.…

A: Quantifying viable bacteria is useful :-

Q: A review of the phylogenetic tree shows a common ancestor for these vertebrates. Which statement…

A: Phylogenetic tree of vertebrates showing common ancestor.

Q: 9. Most species of Clostridium, which are widely distributed in the environment, are harmless to…

A: Infection is the entrance of pathogens into an organism's bodily tissues, their growth, and the host…

Q: Gel-filtration chromatography separates molecules according to their size . Smaller molecules…

A: Gel-filtration chromatography is a type of separation technique that uses a gel as a medium through…

Q: 3) Describe "hub" molecule pyruvate that serves different pathways. Explain metabolic regulation…

A: Introduction: In mammals, metabolic regulation refers to the process through which metabolic…

Q: So far we have discussed changing environments affecting your species at risk. Changing environments…

A: Introduction Environmental effect:- It is the result of environmental impacts on human health and…

Q: Biological functions of DNA

A: INTRODUCTION DNA is required for heredity, protein-coding, and delivering instructions for life and…

Q: Suppose you are researching a new protein and find that the shape of the protein yields little…

A: Suppose you are researching a new protein and find that the shape of protein yields little…

Q: If you add an electron to fluorine, what will result? A) a negatively charged anion O B) a different…

A: Anion: negatively charged ion. Cation: positively charged ion.

Q: Identify the correct group of helminth with sizes of eggs listed from largest to smallest. O…

A: Helminths These are the parasitic worms that can be observed by the naked eye when they are in the…

Q: A single base addition and a single base deletion approximately 15 bases apart in the mRNA…

A: Introduction DNA:- is the hereditary material of an organism. The gene comprises the DNA. The…

Q: birds, trees, etc.) increases from the poles to the equator. Ecologists do not know exactly why, but…

A: Species richness is the measure of biodiversity. The more the species richness of a area, the more…

Q: Describe the synthesis of the leading strand during DNA replication. Assume the replication bubble…

A: Watson and Crick finds that DNA is a two-stranded double helix, giving them insight into how DNA…

Q: What physical activity that can change the blood pressure nd how to restore and maintain to normal?

A: Physical activity that can change the blood pressure.

Q: To determine: The reason for the occurrence of rigor mortis and why it ends only when the myosin…

A: Rigor mortis is primarily caused by chemical changes in the muscles after death, which cause…

Q: A. Fill in the table by comparing the following biological molecules. Biological Molecules Basic…

A: Every living organisms have cells which is the smallest structure and functional unit of the…

Q: What management implications arose from Clements’ theory of succession? How hascontemporary…

A: 'A developmental process through which the community underwent a well-defined series of stages that…

Concept explainers

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. What are the pre-analytical phase in doing the Direct Fecal Smear? 2. Discuss the Cleaning and Disinfection procedure after the stool analysis. 3. Discuss the PPE needed for this procedure and explain the importance of it.
1. What other precautionary measures must be observed in the collection of fecal specimens? 2. If a fecal specimen cannot be examined immediately what must be done? What are the different methods of preserving the specimens? 3. Why should an absorbent container not be used in collecting fecal material?
Which of the following specimens must be removed by steriletechniques?a. feces b. urine c. upper respiratory tract d. blood
Please explain and cite references if possible 1. What is the importance of having a tight-fitting lid for containers of fecal specimen?
In an activity about Preparation and Examiniantion of Direct Fecal Smear Provide the following: 1. Objective 2. Materials 3. Procedure 4. Sample drawing Answer 1,2,3,4
What are alternative testing method for glucose aside from urine test strip? a. Whether the alternative testing method was made before or after the urine reagent strip b. Summarized Procedure c. Causes for False Positives d. Causes for False Negatives
1. Make a step-by-step procedure on how to administer enteral feeding 2. Make a step-by-step procedure on the care of colostomy
How can you collect a fecal sample from a patient for lab testing.
What is the importance of adding NSS and Iodine in direct fecal smear
Please explain in detail Question #1: A urine and culture should be performed on which type of sample? Question #2: Please explain the consequences of ketone in urine.
Which of the following is an important measure that may prevent bacterial contamination in tube feeding formulas? Question 71 options: a) Discarding opened containers of formula not used within 24 hours b) Adding formula to the feeding container before it empties completely c) Using the same feeding bag and tubing each day d) Adding the full days worth of formula to the bag at the start of each day
Source: http://www.hrrsa.org/tours/virtual-tour Questions refer to the treatment of the solid waste. 1. Where does the solid waste go after separation? 2. Is this process aerobic or anaerobic? 3. What does the remaining solid waste become while in the digester?