1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the deoxyribose is present in the 5’ end. Select one: True False 2. Not all missense mutations will lead to nonfunctional proteins. It all depends on where the substitution lies in the polypeptide chain and how it will affect protein folding and activity. Select one: True False 3.What component(s) is/are involved in transcription? a.Sigma factor b.RNA polymerase c.Promoter d.B and C e.All of the above

1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the deoxyribose is present in the 5’ end. Select one: True False 2. Not all missense mutations will lead to nonfunctional proteins. It all depends on where the substitution lies in the polypeptide chain and how it will affect protein folding and activity. Select one: True False 3.What component(s) is/are involved in transcription? a.Sigma factor b.RNA polymerase c.Promoter d.B and C e.All of the above

Name: ANWER FAST NO NEED FOR LONG EXPLANATION1. In the sugar-phosphate backb
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: ANWER FAST NO NEED FOR LONG EXPLANATION1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the deoxyribose is present in the 5’ end.Select one:TrueFalse 2. Not all missense mutations will lead to nonfunctiona

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 11P

See similar textbooks

Similar questions

Need help 1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of 5 nucleotides (aka, a 5-mer) a)How many possible 5-mers are there? Remember that each position in the 5-mer has one of four nucleotides. b) Pick a 5-nucleotide position at random in the genome: what’s the probability that your forward primer matches there? Focus for now just on one strand of DNA. c) Pick a random 5-nucleotide position in the genome: what’s the probability that your forward primer does NOT match there? Focus for now just on one strand of DNA. d) How many physical locations might your forward primer sit in the genome? Focus just on one strand of DNA. Ignore whether or not it matches at a given location. this is one question with different parts. I would really appreciate it if all parts are answered. and I will defiantly rate.
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:
PLEASE ANSWER WHY? Some substitution mutation result in a malfunctioning protein but others do not. Why is this?
TRUE OR FALSE] 11. The structure of the DNA, being super coiled, promotes increased viscosity of the molecule.12. The stacking position of the nitrogenous bases is caused by intramolecular Van der Waals Interaction.13. The histone complex is a quaternary protein structure.14. The difference between ribose and deoxyribose is in the presence of oxygen in carbon number 3 of the sugar moiety.15. The sedimentation coefficient of the nucleic acid is higher compared to ribosomes.
5’-CCTAGACCATAACAT-3’ What happens to the amino acid sequence above as a result of each of the following mutations in the DNA: Substitution of A with T at position 4? Addition of T between positions 8 and 9? Substitution of A with T at position 11? Deletion of A at position 12? Substitution of C with T at position 7? State the type of mutation for each of the base changes indicated.
Junk DNA — Not So Useless After All | TIME.com What was the scientist's error in naming noncoding DNA “junk” DNA. Is the amount of DNA an organism has correlated to intelligence or complexity? What are two discovered uses of noncoding DNA (introns)?
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
2) When DNA is placed in distilled water, which is pH 7.0, it denatures (i.e., the two strands separate). The pH inside a cell is generally 7.2-7.5, depending on the organism, but DNA is generally double-stranded under physiological conditions. Briefly explain, in your own words, why DNA denatures when placed in distilled water but not when it is inside a cell. [Reminder: the pKa for the phosphate groups in the sugar-phosphate backbone of a strand of DNA is 2.14]
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:
1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities now called Chargaff’s rule. With the use of this rule, determine the percentages of all the bases in a DNA molecule which contains 35% thymine. Explain. 2- Similar equalities (i.e. [A]=[U] and [G]=[C]) are however not observed in RNA molecules. Explain the structural differences which dictate why Chargaff rule does not apply to RNA polynucleotides.
just choose dont explain The alternating sugar-phosphate backbone of the DNA is hydrophobic Select one: True False
Which statements are true? Explain why or why not.1 Because the DNA double helix is only 2 nm wide—well below the limit of resolution of the light microscope—it is impossible to see chromosomes in living cells withoutspecial stains.2 A fluorescent molecule, having absorbed a singlephoton of light at one wavelength, always emits it at a longer wavelength.