1. List four classes of membrane-associated proteins and briefly describe the differences between them. 2. What are 3 types of modifications that can anchor proteins to the membrane? How do they link to the proteins they anchor?
Q: What is this TLC's Rf Value
A:
Q: The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’…
A: Start and Stop Codons:In the genetic code, certain codons have specific roles. The codon "AUG"…
Q: . An acetate/acetic acid (pKa=4.75) buffer of 500 mL includes 0.1 mol of acetate and 0.5 mol of…
A: The objective of the question is to calculate the volume of 2.0 M NaOH that was added to the buffer…
Q: Answer the following questions concerning sulfathiazole below by filling ieach blank with the…
A: Step 1: In sulfathiazole, the nitrogen atom is indeed sp² hybridized. This means that one of the…
Q: A drawing of a cell in G2 interphase is provided. The cell contains 4 replicated chromosomes with…
A: A cell in G2 interphase is a stage in the cell cycle where the cell has completed the S (synthesis)…
Q: 9. A) Please write down the names of the following protein folds. A B C B) Which one(s) is made of…
A: C) Haemoglobin the motif is coiled structure which facilitates binding of four polypeptide chains,…
Q: (Biochemistry Topics: Glycolysis and Citric Acid Cycle) - Which of the following molecules can…
A: Gluconeogenesis refers to the process of production of glucose from non-carbohydrate sources.…
Q: At what pH does Aspartate have a net charge of -1 (negative 1)? For Aspartate, the pKa of the alpha…
A: we need to consider the pKa values and determine at what pH Aspartate has a net charge of -1. The…
Q: Hyperacetylation of histone tails is often associated with: Question 22 options:…
A: Loose conformation of Chromatin Explanation:Histone connections with DNA become weaker by…
Q: using sample prep aka the protocol use it to fill in the tables
A: Explanation: Lysozyme (mL): The amount of lysozyme diluted and added to each conical tube. The…
Q: why do so many pharmaceutical drugs contain nitrogen? How would an NH2 group benefit this dimer…
A: The objective of the question is to find the reason why so many pharmaceutical drugs contain…
Q: Number of reactions/steps that are highly regulated during glycolysis is/are __ ☐ 3 ☐ 10 ○ 1 4
A: Multiple steps in glycolysis are highly regulated to ensure the efficient control of the pathway.…
Q: Vmax Km x10 TOOLS
A: Vmax and Km are the two important parameters in enzyme kinetics.Vmax is the maximum rate of an…
Q: Calcium is an important regulator of the citric acid cycle. Calcium is transported across the…
A: Step 1:Step 2:Step 3:Step 4:
Q: None
A: Answer - basic. This amino acid is histidine. It is basic because the side-chain imidazole ring can…
Q: The first human genome was sequenced and pieced together by aligning the sequenced DNA fragments:…
A: The first human genome was sequenced through a process called shotgun sequencing.In shotgun…
Q: Calculate the equilibrium membrane potentials to be expected across a membrane at 37 ∘C, with a NaCl…
A: The objective of this question is to calculate the equilibrium membrane potential across a membrane…
Q: Classify each of the amino acids below. Note for advanced students: none of these amino acids are…
A: Certainly! Amino acids, the building blocks of proteins, are typically classified by the properties…
Q: Under anerobic conditions how many ATP molecules will be produced when 3.5 moles of Glucose are…
A: Glycolysis:In anaerobic conditions, glycolysis is the primary pathway for glucose breakdown.During…
Q: Calculate KI (in units of nmol L-1) for a competitive inhibitor that has α = 1.65 when 11.0 nmol L-1…
A: α=1+ [I]/KIWhere:α (alpha) is the degree of inhibition[I] is the concentration of the inhibitorKI…
Q: An enzyme-catalyzed reaction has a KM of 20.0 mmol L-1 and Vmax of 17.0 pmol s-1. When a mixed…
A: The objective of this question is to calculate the α value, which is a measure of the degree of…
Q: The ability of the liver to regenerate is due to: Question 17 options: a cache…
A: The liver's regeneration is primarily dependent on the presence of a cache or supply of adult stem…
Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…
A: Approach to solving the question: (a) To trace the course of [1,6-(C-14)-2,5-(C-13)]glucose through…
Q: 7 Monomeric protein A reacts with an excess of 2-mercaptoethanol and gives protein B. The latter…
A: Certainly! Let's discuss the queries pertaining to the provided protein structures and reactions:…
Q: 250 150 2 -250 150 100 -100 75 -75 50 -50 37- 37 25 20 15 10 Std Calf Fibrinogen BSA Std Biorad…
A:
Q: Consider the reaction below to answer the following question(s). A B C NO₂ FeBrz + B12 D Fill in the…
A:
Q: 2. What is the major organic product obtained from the following reaction? CH3 Brz FeBr3 CH₂Br CH3…
A: Step 1:
Q: Assume the helium-neon lasers commonly used in student physics laboratories have power outputs of…
A: Please see the attached images for the solution. If there are queries or if the images are not…
Q: To oxidize the fatty acid molecule shown below, what enzyme(s) are needed in addition to the enzymes…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Digestion of cellobiose in cows produces two glucose units which is then absorbed into the bloodand…
A: Now, let's calculate: 1: Glycolysis produces 2 ATP.2:From oxidative phosphorylation, each NADH…
Q: I have glucoseoxidase 1000 Udl-1. What is the exact unit of the enzyme that could work for 1…
A: Specific activity of glucose oxidase (from literature) : 200 units/mg protein Calculation: First,…
Q: 1. Name and briefly describe the function of three different classes of proteins that participate in…
A: 1) Three classes of proteins involved in recognition events to regulate immune responses are:…
Q: Genome. Wide Association Studies: use chip-based array to correlate disease symptoms to SNPs use…
A: Genome-Wide Association Studies (GWAS) typically utilize chip-based arrays to correlate disease…
Q: What is the net yield of ATP when 2 molecules of pyruvate are completely oxidized? (enter numerical…
A: The net yield when 2 molecules of pyruvate are completely oxidized is 20 ATP. When 2 molecules of…
Q: 7.What is an allosteric effect? What is are homotropic and heterotropic allostery? Name one example…
A: Q. 8. ANSWER. (a) θ (Theta): This represents the fraction of protein molecules that bind to the…
Q: what is balanced chemical equation for the oxidation of benzoin to benzil using sodium hypochlorite
A: ### Reactants1. **Benzoin**: This is an organic compound with two aromatic rings bonded together…
Q: A fluorescence recovery after photobleaching (FRAP) was performed at 37 °C. If the experiment were…
A: The objective of the question is to understand the effect of temperature on the rate of fluorescence…
Q: Suppose that we sample a signal at fS = 250 Hz and get alternating values of -2 and 6 V. (a) What do…
A: here we will be using Nyquist-Shannon sampling theorem ,The theorem states that to accurately…
Q: 4. Both the constant domains and variable domains of immunoglobulins are formed by beta-barrels. For…
A: Beta-Barrels in Immunoglobulins:a. Interaction between Heavy and Light Chain Barrels: The constant…
Q: Determine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG…
A: The isoelectric point, also known as the pI, of a protein or peptide is the pH at which it has no…
Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…
A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…
Q: 3. What is the IUPAC name of the following compound? NH2 NH2
A:
Q: Regulation of enzyme activity 1. Allosteric control 2. Covalent modification (on/off switch) 3.…
A: Allosteric Control:Allosteric regulation involves the binding of a regulatory molecule to an…
Q: In bacteria, what is the role of the Shine-Dalgarno sequence? Question 3 options: It binds to…
A: The Shine-Dalgarno sequenceRibosomal binding site in mRNA.It enables initiation of protein synthesis…
Q: How will the information required to describe your RFP be obtained? Which kinds of methods are you…
A: Step 1: Document Analysis:The lab introduction provided is a crucial source of information. By…
Q: Which of the following factors does not pay for the generation of NADH and ATP during steps 6 and 7…
A: The factor that does not directly contribute to the generation of NADH and ATP during steps 6 and 7…
Q: Which feature of an enzyme, distinct from non-enzyme proteins, relates specifically to their…
A: The question is asking us to identify the unique feature of enzymes that is directly related to…
Q: Chimeric Antigen Receptor T cells (CAR T cells): Question 26 options: Are…
A: Chimeric Antigen Receptor T cells (CAR T cells) are a type of immunotherapy that involves…
Q: A specific single nucleotide variant in the human genome occurs with a 5% frequency in the general…
A: In the given question, the keywords we need to understand is that the variant does not change the…
Q: Investigating the effect of water potential on osmosis in potato chips. Describe the scientific…
A: Finally, basic ideas of physical chemistry and cell biology are clarified by the experiment…
Step by step
Solved in 2 steps
- 1. The cells of a celery stick have a salt concentration of 1% and a nucleic acid concentration of 4%. The celery stick is placed into a glass of salt water solution. The solution contains a salt concentration of 0.6% and a nucleic acid concentration of 6%. The salt can pass through the membrane, but the mucleic acids cannot. a) Describe the movement of the ions and the end results. Use appropriate terminology to explain your answer. b) Draw a labeled diagram of the movement of water (assume that only the substances mentioned can influence the movement of water).Describe the various types of specialized domains that can be established in the plasma membrane? what is the general consequence of these domains (ie why form them )?9. Recall that many cells have polarity (as in directionality, in this case). Consider the apical location of a particular protein (A) expressed in epithelial cells, illustrated in the figure above. Which type of defect described below is the most likely to cause the redistribution of that protein around the entire cell? A) A nonfunctional enzyme glycosylase. B) The deletion of a junctional protein. C) The truncation of a protein found in the extracellular matrix. D) A nonfunctional flippase. Answer: Explanation: apical plasma membrane lateral plasma membrane basal plasma membrane basal lamina protein A tight junction
- 2. The figure below illustrates a cell membrane with four associated proteins (A-D). For each protein, indicate if it is an integral or peripheral protein. Briefly explain how you know? A ..... B Da) Give the two main membrane proteins.b) State a function each of the mentioned protins. c) Explain why change in pH can affect the function of the proteins.What is the primary characteristic of peripheral membrane proteins? A: They cannot be post-translationally modified. B: They span the entire lipid bilayer, sometimes multiple times. C: Detergents or nonpolar solvents are necessary to remove them from the lipid bilayer. D:Weak intermolecular forces keep them attached to the lipid membrane.
- 11. Treatment of disrupted erythrocyte membranes with a concentrated salt solution released an unknown membrane protein, X. Proteolytic enzymes cleaved X into fragments. In additional experiments, intact erythrocytes were treated with proteolytic enzymes, washed, then disrupted. Extraction of membrane components yielded intact X. What do these observations indicate about the location of X in the plasma membrane? Do the properties of X resemble those of an integral membrane protein or a peripheral membrane protein?List and describe the three main types of cytoskeleton. If you wanted to do immunocytochemistry to specifically stain each type of cytoskeleton, what is a protein that could be used for each cytoskeletal type (in other words, what is a unique protein for each cytoskeletal type)? What are three types of actin structures? Describe the involvement of actin structures in cell migration. How is the growth and shrinking of microtubules regulated? Then describe the roles of microtubules in: chromosomal separation during mitosis and the movement of organelles and vesicles within a cell. Describe a possible mechanism on how signaling pathways might impact the cytoskeleton, so that cell migration could be regulated in a localized manner within a multicellular organism. (hint: think about the possible transcriptional regulation of the G-protein regulators) What are 2 main challenges of protein targeting? Then describe one way these challenges are overcome during signal-based targeting and one way…What type of plasma membrane protein provides the means for moving materials across the plasma membrane? What are three subtypes?
- 1. Lysosome is regarded as a body that is covered by membrane, a little smaller than mitochondrion and functions as storage for several hydrolytic enzymes. The enzymes in lysosome can digest substances that are engulfed by the cell and under certain conditions can destroy the cell itself. (a) Name ONE type of cell in the human body that contains many lysosomes. Explain why the cell contains many lysosomes. (b) State ONE different between the lysosome membrane and the mitochondrion membrane. (c) State ONE special feature of the lysosome membrane. (d) Explain how lysosome acts to release its enzymes in the cell.9. The Golgi apparatus has a polarity or sidedness (ie., cis and trans faces) to its structure and function. Which of the following statements correctly describes this polarity? A) Transport vesicles fuse with one side of the Golgi and leave from the opposite side. B) Proteins in the membrane of the Golgi may be sorted and modified as they move from one side of the Golgi to the other. C) Soluble proteins in the cisternae (interior) of the Golgi may be sorted and modified as they move from one side of the Golgi to the other. D) All of the above correctly describe polar characteristics of the Golgi function.Imagine protein X, destined to span theplasma membrane. Assume that the mRNA carrying the geneticmessage for protein X has already been translated by ribosomesin a cell culture. If you fractionate the cells (see Figure 6.4), inwhich fraction would you find protein X? Explain by describingits transit through the cell.