1. Ribosomes play a key role in

Q: The RNA components of ribosomes are synthesized in the ________. a. cytoplasm b. nucleus c.…

A: The ribosome is composed of protein and ribosomal RNA .ribosomes involves in carrying the mRNA…

Q: C 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…

A: DNA is ladder like , two strand structure that act as genetic material in most of Organism.…

Q: D Question 2 The type of protein made by a ribosome is determined by O the Keebler Elves. O introns.…

A: Proteins are made up of amino acids. Long-chain amino acids are called polypeptides.

Q: 15. Ribosonmes are not found in or associated with chloroplasts. mitochondria. the Golgi apparatus.…

A: Answer - Option (3) is correct. - Golgi apparatus

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: Outline the structural features of ribosomes.

A: The ribosome is a complex cell organelle which is made up of ribosomal RNA molecules and protein…

Q: What are 3 sites of ribosome?

A: The translation is a molecular process that involves the synthesis of a polypeptide chain of amino…

Q: 1. Which te of the following are major structural Compenents of the cell membrane? cellukose mucleic…

A: A biological membrane that distinguishes the inner side of the cell to its outer environment, is…

Q: 1. What are the amino acids translated from the resulting mRNA?

A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…

Q: 8. Some antibiotics work by preventing protein synthesis in bacteria by binding to their ribosomes.…

A: Multiple choice answer is given below:

Q: Biologists classify both ribosomes and spliceosomes as "ribozymes" because ... they both contain…

A: Please follow step 2 for a detailed explanation.

Q: The RNA components of ribosomes are synthesized in the O A. chloroplasts O B. nucleus O C. cell…

A: Given that ribose sugar is a component of RNA's structure, this nucleic acid is also known as…

Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC

A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…

Q: 1. What is the purpose of protein synthesis?"

A: noIntroduction:-  Protein synthesis is process in which polypeptide chains are formed from coded…

Q: 1. What is the main difference between a prokaryotic cell and a eukaryotic cell? A-Prokaryotic cells…

A: Eukaryotic cells are those cells which are more complex in nature as compared to the prokaryotic…

Q: 5. Which proteins are required for RNA synthesis? 1. Helicase 2. Primase 3. Sigma factor 4. Ligase…

A: Note - Since you have asked multiple questions, we will solve the first question mentioned by you.…

Q: 2. What would happen if a mutation in DNA changed codon 6 in the MRNA to GUA? (This one nucleotide…

A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: Which of the following statements regarding ribosomes is false? O The large subunit binds tRNA They…

A: Ribosomes are certain substances which are present in both eukaryotes and prokaryotes. They are…

Q: it consists of cellulose and glycoproteins that protect and provide structural support to the cell…

A: Since you have asked multiple questions , we will solve the first question for you. If you want any…

Q: 7 .Alzheimer disease results from a defect in function of; A „Ribosome B.Mitochondria C.Golgi…

A:

Q: 1. Research on how are hydrogen bonds involved in the transfer of genetic information? CITE YOUR…

A: DNA and RNA are nucleic acids, which are large linear polymers that hold data in a format that can…

Q: Chromatin is composed of: a. MRNA and ribosomes O b. DNA and RNA c. rRNA and protein O d. rRNA and…

A: There are two types of chromatin. Euchromatin is a less compacted type of chromatin that can be…

Q: 1. What is a cytoskeleton? What are its main constituents in animal cells?

A: The question is asking about cytoskeleton which are the part of a cell which holds the rigidity of…

Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…

A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…

Q: 2. The sequence of bases in a segment of mRNA is UUUCAUAAG. Answer the following questions: a. What…

A: mRNA is the transcript that is produced during the process of transcription from DNA by the enzyme…

Q: Discuss the 4 major processes of lysosomes.

A: Lysosomes are sphere- shaped sacs filled with hydrolytic enzymes having capability to catabolise…

Q: A tRNA to which the correct amino acid has been attached is called

A: tRNAs bind to codons within the ribosome and deliver amino acids for the protein chain to be…

Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…

A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…

Q: How ribosome is made inside the cell?

A: Cells: [plant/animal]               Cells are the basic unit of life as they compiled in discrete…

Q: b. 3, 20, C. 4, 20 d. 20, 4 necessary for protein synthesis to occur: a tRNA b. MRNA c. ribosomes d.…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: 2. Which of the of the three compounds lead directly to life? (a) DNA RNA Protein (Ⓒ) Ans:

A: DNA a self-replicating material that is present in nearly all living organisms as the main…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…

A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…

A: Introduction: The process of copying the genetic information from one strand of the DNA into RNA is…

Q: Where in the cell does translation occur?

A: Ans.Translation is the process by which a protein is synthesized from the information contained in a…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…

A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…

Q: 1. Decoding mRNA into amino acids is called translation.

A: above given statements are about transcription, translation process and how amino acids makes a…

Q: Discuss the difference between intron and Exon

A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…

Q: What's the difference between lysosomes and peroxisomes?

A: A cell is the basic unit of life. They have various parts and functions. Each cell is composed of…

Q: 2. How ribosome is made inside the cell?

A: Cells are the basic functional building blocks of all the living beings. The cells play a major role…

Q: 1) Ribosomes Select an answer and submit. For keyboard navigation, use the up/down arrow keys to…

A: Ribosomes are one of the important organelles of the cell that catalyzes the formation of…

Q: 1. What is connecting the peptidoglycan subunits together in the cell wall? A. D-Alanine B. Peptide…

A: C.  NAG+NAM

Q: I. Amino acids bond together to form a polypeptide chain. II. A specific anti-codon on Transfer RNA…

A: Protein synthesis is the process in which cells make proteins.It occurs in two stage transcription…

Q: 1.  The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…

A: Answer:-  The process in which the peptide bonds formation occur in between the ribosome called…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.