Q: b) Fill in the blanks. I) In 1940 2) NBPGR stands for proposed RSGCA for developing synthetic variet...
A: RSGCA is utilised to enhance traits that are controlled by additive genes. With inadequate dominance...
Q: .32 10 p^2 68 q^2 .46 2pq .1 Number of Mottled 90 Individuals Number of Orange .44 Individuals
A: The Hardy–Weinberg principle, also known as the Hardy–Weinberg equilibrium, model, theorem, or law i...
Q: Gould and Lewis make the claim, "Our energy-related social, environmental and public health problems...
A: Renewable energy is the energy from natural resources and it can be regenerated naturally.The major ...
Q: Imagine you will use a centrifuge in the laboratory indicating rpm and your protocol requires 3500xg...
A: Centrifuge Device: A centrifuge is a laboratory apparatus that separates fluids, gaseous or liquid...
Q: What is the value of the 2-hour postprandial blood sugar level above which the dose of an oral antid...
A: A post prandial blood sugar of more than 200 mg/dL is considered DIAGNOSTIC of Diabetes Mellitus and...
Q: In individuals affected by cystic fibrosis, salt crystals may appear after perspiration dries up. In...
A: Cystic fibrosis It is an autosomal recessive disorder that affects mucus-producing cells. This disor...
Q: What is apoptosis? How is it beneficial to the body?
A: APOPTOSIS: * Apoptosis is a type of programmed cell death in which some steps in cell will leads to...
Q: Multiple Alleles: Punnett Square 1. CCch X Cc 2. Cc X Cc
A: 1. CCch X Cc
Q: Which of the following are the inputs of the light reactions? Choose all that apply. carbon dioxide ...
A: The photosynthesis is the process by which chlorophyll containing organisms produce their own food (...
Q: autoimmune diseases?
A: Autoimmune disease : A disease in which the body's immune system attacks healthy cells.
Q: Please arrange the following ecological organization in a hierarchical order, from the broader scale...
A: Ecological organization in a hierarchical order, from the broader scale to the most exclusive scale:...
Q: egarding the endocrine system, which of the following statements is FALSE? A. Hormone secreted durin...
A: Various physiological systems constitute the human body. There are a total of 12 organ systems in th...
Q: Q14
A: The sensitiveness of an organelle to a particular stimuli is based on the fact that how it reacts in...
Q: At the hydrothermal vent in the deep sea, the specific symbiotic relationship between the bacteria t...
A: A close ecological link between organisms of two or more species is known as symbiosis. Sometimes bo...
Q: Give the shared characteristics of the following animal groups: 1. Cartilaginous fishes & Ray-finne...
A: Ray - finned fishes are also known as Bony fishes . According to the guidlines of bartelbey i am all...
Q: A 14-year-old boy experiences severe, prolonged bleeding following a tooth extraction. He also has a...
A: Mendel is renowned as the "Father of Genetics" because he discovered and described the rules of here...
Q: What ion and ion channels does a muscle cell have?
A: Muscle is a specialized tissue that arises from the mesodermal layer and aids in an organism's movem...
Q: : select all that apply, more than one answer
A: Photic zone, Abyssal Zone, Limnetic zones are the ones which received adequate light from the sun an...
Q: Select all the true statements about cyclins: (select all that applies) Group of answer choices Th...
A: Cyclins : These are named because they undergo a constant cycle of synthesis and degradation during...
Q: how each monomer type is catabolized into simpler molecules for the purpose of energy extraction.
A: * Basically the food we take includes proteins, carbohydrates and fatty acids are complex molecules ...
Q: Explain what makes Thomas Hunt Morgan an interdisciplinary thinker with his Fruit fly discovery
A: Morgan chose the fruit fly, Drosophila melanogaster, for his genetic studies. fruit flies may lack i...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: It is estimated that every human carries at least one recessive lethal allele (i.e. they are heteroz...
A: In diploid organisms such as humans, the efficacy of selection on a deleterious mutation depends bot...
Q: Please choose all that apply for Phylum Arthropoda. segmentation coelom hemocoel O endoskeleton O op...
A: Introduction:- Animals without a notochord – the rod-like elastic structure that supports the body –...
Q: How do fungi threaten global wheat production?
A: Fungi are eukaryotic organisms that include microorganisms like yeasts and molds, as well as the mor...
Q: Explain the purpose and phase where cells lose flagella and motility in biofilm formation, and why t...
A: There are several steps associated with the biofilm formation. The first step includes adherence of ...
Q: environment
A: Insects adaptations include mouth parts, the ability to fly,leg types and body shapes... They die, t...
Q: Null hypothesis If the Hydrilla plant is placed in light conditions, then it will undergo photosyn...
A: This question is about null hypothesis.
Q: Which type of molecule recognizes macromolecules that are present in/on certain groups of pathogens?...
A: Introduction: Phagocytosis is a process in which the phagocytic cells engulf the microbes. It is an ...
Q: List and explain in your own words the 5 mechanisms of antimicrobial drug resistance
A: Introduction: Antimicrobials selectively destroy/prevent the formation of germs such as bacteria (an...
Q: If an organism is 2n=12, How many chromatids are present in prophase of mitosis? 1. 6 How many bival...
A: The indirect process of cell division by which the somatic parent cell divides once to produce two d...
Q: Trivia about analogous structures
A: Analogous structures in evolutionary biology are biological structures with similar or corresponding...
Q: Breast feeding confers what type of immunity to an infant? O Artificially acquired active
A: The immune system is the human body's defence mechanism against foreign particles such as bacteria, ...
Q: escribe and discuss the importance of at least three specific skeletal features (these can be either...
A: Essential features of skeletal framework of Hominis which differentiated them from rest of species a...
Q: When a neuron is inactive, more of which of the following exist OUTSIDE the neuron? A. Myelin sheath...
A: Neuron is the fundamental unit of brain and nervous system. Neurons transmit signals from brain to t...
Q: Which of these statements best demonstrates the difference between the action of B cells and T cells...
A: B cells secrete antibodies that contribute to tissue injury via multiple mechanisms. In addition, B ...
Q: As a rule of thumb, each 1% of soil organic matter by weight contains about 1,000 pounds of nitrogen...
A: Any material created by living organisms (plants or animals) that is returned to the soil and decomp...
Q: Q8: select all that apply more than one answer
A: Super cooling is not used to preserve heat. Isozymes are not related to temperature regulation as su...
Q: What traits or innovations allowed movement of animals onto land, and why might these traits have be...
A: Physical or behavioural adaptations are possible. A physical adaptation is a form of structural adju...
Q: outline the use, description, history, and functionality of a compound light microscope
A: Description of Compound Microscopes:- A compound microscope is an upright microscope that uses two ...
Q: Please help me answer this reviewer. Determine what the statement is describing. Fill in the blanks...
A: 1. Non-lethal storage of biological material at ultra-low temperature that almost all metabolic acti...
Q: Under which scenario can a hawk successfully invade (or persist among) a population of doves? Grou...
A: The evolutionarily stable strategy, often known as the Hawk-Dove Game hypothesis, is a famous exampl...
Q: aerobic and anaerobic respiration, NADH is oxidized to return to NAD+ which is needed for Glycolysis...
A: Aerobic respiration can be described as the process involving the breakdown of carbohydrates such as...
Q: Which of the following statements is true: O invagiantion is folding of cells that happens early in ...
A: Blastocoel is a fluid filled cavity in blastula. First the morula(60 or more cells) is formed then t...
Q: What do you call the movement in which the yolk plug is formed in amphibians?
A: Introduction:- The residual patch of endodermal cells generated after the formation of the dorsal li...
Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe ...
A: Introduction: The process of polymerization of amino acid to form a polypeptide is called translatio...
Q: If p = .5, calculate q, p^2, 2pq, q^2. Select all the answer below that are correct. Note p2 and p^2...
A: Here given, p= 0.5 According to Hardy Weinberg Equilibrium, We know that : p+q= 1 If p= 0.5 then q=...
Q: 2 6 5 MAGIC CUP 3.
A: The above image shows different types of sharks, the identification of these are: 1) Rhincodon typu...
Q: Please choose all that apply for Phylum Echinodermata. water vascular system endoskeleton O eutely O...
A: An echinoderm is any member of the phylum Echinodermata, organisms belonging to the phylum Echinoder...
Q: Which of the following statements are correct? * Extended trade territories, increased travels as we...
A: Due to extension of territories, travel and increasing in human population , an infectious disease ...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- QUESTION 11 You are examining a new population that has recently migrated to and colonized a new island. Which of the following characteristics would you expect to see in your population? a. The new population will likely experience genetic drift related issues related to the founder effect. b. The new population will suffer more the effects of mutation because this is a bottleneck event. c. The new population will have high levels of heterozygosity and allelic richness. d. The new population will most likely have the same allele frequencies as the original population.QUESTION 5 What are the allele frequencies for the gene that controls coat color in Rhosgobel rabbits? AA: 32, Aa: 54, aa: 14Question 2. A widow's peak hairline is a dominant trait and a straight hairline is a recessive trait. What will be the genotypes and phenotypes of children of a homozygous dominant parent and a heterozygous parent? a) Construct a Punnett Square - List gametes in the area with the dashed line and the genotypes of the offspring in the area with the sold line. b) Genotypes of Children-c) Phenotypes of children-
- QUESTION 4 You are examining a population of snails in their naturally varying habitat (including parasites) in the wild. You manipulate the population to include a greater proportion of asexually reproducing individuals, although there a few sexually reproducing individuals still remaining. The parasite populations peaked in abundance in the following year. What would you expect to see in the population after returning a year later? a. There would be only asexually reproducing individuals. b. There would be more sexually reproducing individuals. c. There would be no change in abundances from the initial manipulation. d. There would be an even number of sexually and asexually reproducing individuals.QUESTION 31 You are examining a population that has recently been subject to artificial selection for larger filet size (body size) through selective breeding in a commercial fishery. The artificial selection took quite a few generations, but the researchers were eventually successful. Which of the following statements is most likely true? a. There is likely no correlation between parent and offspring filet size (body size). b. The population experiencing artificial selection always has higher fitness than wild populations. c. The offspring of the selected population will, on average, be larger than the wild populations. d. The filet size (body size) of the fish is most likely controlled by a single gene.QUESTION 8 In a certain population of rabbits, 25 new rabbits are born and five move into the population from surrounding areas during a single year. However, 10 rabbits die, and five leave the population during the same time frame. What is the population change for that year? a. 30 b. No change c. 15 d. 25 e. 10
- Question 1.You have sampled a population in which you know that the percentage of the homozygous recessive genotype (aa) is 36%. Using that 36%, calculate the following: A) The frequency of the "aa" genotype. B) The frequency of the "a" allele. C) frequency of the a allele, then the frequency is 60%. Question 6A very large population of randomly-mating laboratory mice contains 35% white mice. White colouring is caused by the double recessive genotype, "aa". Calculate allelic and genotypic frequencies for this population. Question 7After graduation, you and 19 of your closest friends (lets say altogether 10 males and 10 females) charter a plane to go on a round-the-world tour. Unfortunately, you all crash land (safely) on a deserted island. No one finds you and you start a new population totally isolated from the rest of the world. Two of your friends carry (i.e. are heterozygous for) the recessive cystic fibrosis allele (c). Assuming that the frequency of this allele does not change as…QUESTION 9 Recent genetic research indicates that ____ or more individuals are needed for an endangered species to maintain its capacity for biological evolution. a. 100 b. 1,000 c. 10 d. 100,000 e. 10,000Question 4: What percentage or Americans believe that evolution does not occur and that humans and all other living things have only ever existed in their present form? A. Less than 20%B. Between 20% and 40%C. Between 40% and 60%D. Between 60% and 80%E. More than 80%
- QUESTION 1 Which of the following statements is true? a. Evolution is a completely random process. b. Evolution is synonymous with natural selection. c. Evolution only occurs in individuals. d. Evolution is defined as change in allele frequencies over time.Question 1.You have sampled a population in which you know that the percentage of the homozygous recessive genotype (aa) is 36%. Using that 36%, calculate the following: A) The frequency of the "aa" genotype. B) The frequency of the "a" allele. C) frequency of the a allele, then the frequency is 60%. D) The frequency of the "A" allele. E) frequency of A is by definition equal to p, so the answer is 40%. F) The frequencies of the genotypes "AA" and "Aa." G)The frequencies of the two possible phenotypes if "A" is completely dominant over "a."QUESTION 3 Which of the following is a false statement about the Hardy-Weinberg Principle? a. It needs a large population b. No mutations or natural selection of an allele can occur c. It requires a random mating population. d. Migration is essential to maintain allelic frequency
