1.Knowing that the Control is 6.22 x 10- moles.channel-2sec-1 and the CFTR-CRISP is 3.84x 10-20 moles.channel-2.sec-1 Show me how they got their answer and explain how?
Q: plz state 2 importance of the following importance of, algal bloom: Phylum Chlorophyta, Phylum…
A: Algal blooms are rapid and excessive growths of algae in water bodies, which can lead to the…
Q: Explain briefly how proteins synthesized in the cytosol get into mitochondrial matrix.
A: Protein synthesis refers to the process by which cells generate new proteins, which are essential…
Q: A) What is resident flora? B) How might resident flora prevent infection AND cause infection?
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Conclusion: Which regulatory mechanisms promote the increase of MLV during exercises
A: According to the given question ,the column to be filled following the graph algorithm provided is…
Q: Tapeworms are common parasites. Which of the following categories best describes a tapeworm? A.…
A: ANSWER) Tapeworms are the parasites which are capable of living in the human intestine and can cause…
Q: 1.What impact does lameness have on dairy cows in Puerto Rico?
A: lamenesses is A state of being unable to walk because of leg or foot pain is lameness. Old dog's…
Q: A bacterial organism is catalase positive and cytochrome oxidase positive. This could suggest that…
A: The oxidase test is a biochemical test that is used to determine the presence of an enzyme called…
Q: A discrete, identifiable physical feature or behaviour of an organism present in every individual of…
A:
Q: What is the correct Labelling? the above labelling is wrong.
A: The diagram depicts the C4 cycle also called Hatch and Slack pathway. This pathway efficiently fix…
Q: How have opiate analgesics been reformulated to reduce undesireable side effects?
A: Introduction Analgesics are a class of drugs that are used to relieve pain. They work by reducing…
Q: In their case-control study investigating the link between smoking and lung cancer, Doll and Hill…
A: Control selection is the process of selecting participants who do not have the outcome of interest…
Q: Which of the following drug classes is named according to its characteristic large chemical ring…
A: Macrolide antibiotics include drugs such as erythromycin, azithromycin, and clarithromycin, among…
Q: Select the statements that correctly describe hydroelectric power. Its plants have short lifespans…
A: Introduction: Environmental pollution refers to the presence or introduction into the environment of…
Q: application. NOTE: If none of the options are correct, you MUST select #4for 'none of the above',…
A: All these are plant hormones with different functions. These are produced in extremely low…
Q: Describe and explain sources of errors in this experiment. Provide practical suggestions for…
A: Protein solubility refers to the ability of a protein to dissolve in a solvent such as water, and is…
Q: b. Do the annual rings of the fish scale remind you of growth rings found in another, very different…
A: Growth rings are an intriguing characteristic of certain organisms that indicate their age and…
Q: 10.
A: Epigenetic regulation refers to the mechanisms that control gene expression without changing the…
Q: Give typing answer with explanation and conclusion How are these two processes (photosynthesis and…
A: Introduction :- Photosynthesis is the process by which plants, algae, and some bacteria convert…
Q: What mechanisms does the phagolysosome use to kill the thing that was brought into the cell?
A: Introduction The immune response is a complex biological process by which the body's immune system…
Q: Using the data available Using the data available on Moodle describe the phenotype that you observe…
A: RNA interference (RNAi) is a successful strategy for examining gene action and direction. Analysts…
Q: The ______ phase of HIV infection is asymptomatic. This is the phase in which HIV replication…
A: Introduction : AIDS, also known as acquired immunodeficiency syndrome, is a chronic, potentially…
Q: Journal research update related to OB Surgical published from 2021 to 2023. And attach a reaction…
A: Introduction OB surgical refers to surgical procedures that are performed during pregnancy,…
Q: phosphofructokinase is an allosteric enzyme that catalyzes the conversion of fructose 6-phosphate to…
A: In mammals, the allosteric regulation of phosphofructokinase is primarily achieved through the…
Q: Accessibility to playgrounds and/or parks could potentially help reduce childhood obesity. As an…
A: Study design refers to the specific plan or strategy that researchers use to conduct a study and…
Q: 2. Carefully analyze the following images. D A X ! E | B a. Describe each as _n= (1 or 2 "sets" of…
A: Cell division is a process in which parent cell splits and give rise to new cell . Number of new…
Q: Why is penicillin toxic to bacteria but not to higher organism? Explain briefly
A: Penicillin is an antibiotic drug that was discovered in 1928 by Alexander Fleming, a Scottish…
Q: Sucrose-6-P Glucose-6-P Cytoplasm Cell wall Cell membrane hasC Glucose-1-PUDP-Glucose hasB HA…
A: Operon is a group of genes that is present in the same region of the DNA. It consists of a…
Q: Your friend Chad is carrying some firewood in his outstretched arms. While his eyes are closed…
A: Introduction The Golgi tendon is a proprioceptive sensory receptor located in the tendons of…
Q: A patient visits an urgent care center with complaints of a stiff neck and headache. While…
A: Flow cytometry is a technology used to analyze individual cells or particles in a fluid suspension.…
Q: ab questions (due at the start of the You will examine four different phyla this week. Which of…
A: Acoelomates-An acoelomate is an animal that does not possess a body cavity or coelom.…
Q: make a mind map for N2 fixation. amino acid synthesis and amino acid degredation.
A: The mechanism of biologically fixation of nitroge is a process in which aerobic nitrogen is…
Q: Why is a positive and a negative control used in a Elisa experiment?
A: The enzyme-linked immunosorbent assay (ELISA) is a laboratory technique for detecting and…
Q: Would you donate a kidney to a friend of family member whose kidneys were failing? Would you…
A: Living kidney donation is one of the best options for the people needing new kidney. To donate to a…
Q: The drug tamoxifen has been used to treat some types of breast cancer. Suppose even among female…
A: Breast cancer is one of the most common cancers affecting women worldwide. Tamoxifen, a selective…
Q: How much dry matter (kg/DM per day) does a 500kg cow in early lactation producing 1.7kg milksolids…
A: To calculate the dry matter intake required for a 500kg cow in early lactation producing 1.7kg of…
Q: The resting membrane potential is established by? The Na+/K+-ATPase pumping Na+ into the cell and…
A: Introduction Resting membrane potential is the electrical charge difference that exists across the…
Q: Please put your answer in the word document link provided.…
A: Criminal Investigation: Criminal investigation is the process of gathering evidence and information…
Q: Consider a one-locus system of simple dominance where the presence of at least one G allele results…
A: A genotype is a scoring of the type of variant present at a given location (i.e., a locus) in the…
Q: Variation in Alleles Allele frequency - Allele frequency, or gene frequency, is the relative…
A: Introduction An allele is one of the possible forms of a gene that is found at a specific location,…
Q: Identify the solution or solutions with the highest concentration of water. Justify your answer.…
A: Osmolarity: Osmolarity is a measure of the concentration of a solution expressed as the number of…
Q: A single meal a day is enough to feed a cat. Is that premise a myth or a reality? explain
A: Cats' dietary demands and eating habits are affected by their evolutionary history as hunters.…
Q: 2. In some cats the gene for tail length shows incomplete dominance. Cats with long tails and those…
A: A heterozygous one that exhibits an intermediate phenotype between two homozygous phenotypes is…
Q: The effects of climate change on the sustainbility of the seafood industry now and in the future…
A: Sustainability is the ability to maintain a certain level of activity or a particular state or…
Q: The hormone oxytocin relaxes the muscles and ligaments in the pelvis and softens the cervix in…
A: In addition to being released during intercourse, following ovulation, labor, childbirth, and…
Q: Give typed full explanation A drug has been developed that blocks complex 1 of the mitochondria…
A: The electron transport chain is a series of membrane-associated protein complexes located in the…
Q: Benzodiazepines bind to & activate GABA receptors. This drug is: (SELECT 2) (a) Direct (b)…
A: Introduction: Benzodiazepines are a class of psychoactive drugs that are commonly used to treat…
Q: All of the following are epidemiological study designs are "observational" in nature, except a.…
A: The incidence and distribution of diseases and health-related events in populations are studied…
Q: 7. please answer this
A: Homozygous and heterozygous are terms used to describe the genetic makeup or genotype of an…
Q: Where and how photosynthesis occurs? What are its products?
A: introduction Green plants and some other animals transform solar light energy into chemical energy…
Q: Calculate the pasture mass (kgDM/ha) for cows, given a (RPM) plate meter start reading of 9566, a…
A: The RPM plate meter measures the compressed height of pasture in half-centimeter increments. The…
Step by step
Solved in 2 steps
- Horizontal sequence :RIVL Vertical sequence:FMK Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. NW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: R I V L F M K 2. Set up, initialize and complete the NW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). R I V L F M K Align and score all optimal alignments here. PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment Here the following…Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATTTask 1. Your graduate advisor asks you to amplify the following sequence of DNA by PCR: 5’-ATACGCATTCGGACCAGGTCCTAA-3’ 3’-TATGCGTAAGCCTGGTCCAGGATT-5’ a. To ensure that the entire sequence above is amplified, what 6-nucleotide DNA primers should you add to your PCR mix? You order the primers listed above, but instead receive the following set of primers: 5’-CGCATT-3’ 5’-GGACCT-3’ b. What portion of the double stranded DNA molecule will be amplified after 10 rounds of PCR? Your labmate attempts to rescue your PCR reaction by providing you with the following set of primers: 5’-ATACGC-3’ 5’-TCCTAA-3’ c. What is the result of running the PCR reaction with your labmate’s primers? How many double stranded molecules of DNA will result from 10 rounds of amplification?
- Titled “Techniques utilized to generate a genetically engineered organism and confirm gene disruption.” a. In the table, indicate with an "x" if the reagent or technique applies to DNA, RNA, and/or protein. You can have more than one "x" in each row or none at all.Which BLAST program should we use in this case? (HINT, what type of sequence are you provided with?)Horizontal sequence :RIVL Vertical sequence:FMK Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. SW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: R I V L F M K 2. Set up, initialize and complete the SW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). R I V L F M K Align and score all optimal alignments here. PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment Here the following points…
- Please answer asap and type your answer and do not copy from anywhere please NOTE*** double stranded complementary DNA I have determined is GTCATACCTAGGGTA with a palindromic site of CCTAGG and the enzyme BamHI that will cut the recognition site. In the double-stranded DNA you have determined, there is also another recognition site for common restriction enzymes. Which enzyme would cut your DNA at this other recognition site? (Hint: Remember that one recognition site can overlap with or be completely contained by the sequence containing another recognition site.) HindIII Sau3AI AluI BamHIplease help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenNeed help, please. Please answer the following four questions to the image I attached. 1. You digest both plasmids with BamHI and SacI together (a double digest). What size fragments will result? Please indicate the sizes of the expected fragments in basepairs: The large fragment of pNUT is fragment A. This fragment is expected to be ____ bp. 2. The small fragment of pNUT is fragment B. This fragment is expected to be ____ bp. 3. The large fragment of pPOD is fragment C. This fragment is expected to be ____ bp. 4. The small fragment of pPOD is fragment D. This fragment is expected to be ____ bp.
- Horizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. SW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: V I R L M K F 2. Set up, initialize and complete the SW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). V I R L M K F Align and score all optimal alignments here.Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing. ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGACPlease help witht this homework question A- What are the topological parameters (linking number, twist, and writhe)for a relaxed, 4,200 base pair circular double-stranded DNA plasmid? LK=? Tw= ? Wr=? The CRISPR-Cas9 protein first forms a protein-RNA complex with a guide RNA, and then binds to DNA sequences that match a 20-base target sequence within the guide. When the CRISPR-Cas9 complex binds to DNA, it unwinds about 20 base pairs of the DNA double helix. B- Why is DNA unwinding required for CRISPR-Cas9 protein-RNA complexto recognize target sites? C-How would the topological parameters (linking number, twist, andwrithe) of the 4,200 bp plasmid in (A) change when the CRISPR-Cas9 complex binds the DNA and unwinds about 20 bp? Lk=? Tw=? Wr=? D- What is the linking number after the CRISPR-Cas9 complex cleaves theDNA?