14. Guanine normally pairs with cytosine. Oxidative damage can result in the modification of guanine to 8-oxoguanine. What is the potential mismatch in nucleotides that can occur following replication? 8-oxoguanine pairs with Adenine 8-oxoguanine pairs with thymidine Thymidine pairs with adenine Guanine pairs with Cytosine None of these choices. Question 8 The key enzyme that transfers an a-amino group from an amino acid to an a-keto acid is : Glutamate Dehydrogenase Transaminase Synthetase Glutamine PRPP Amidotransferase Glutaminase

14. Guanine normally pairs with cytosine. Oxidative damage can result in the modification of guanine to 8-oxoguanine. What is the potential mismatch in nucleotides that can occur following replication? 8-oxoguanine pairs with Adenine 8-oxoguanine pairs with thymidine Thymidine pairs with adenine Guanine pairs with Cytosine None of these choices. Question 8 The key enzyme that transfers an a-amino group from an amino acid to an a-keto acid is : Glutamate Dehydrogenase Transaminase Synthetase Glutamine PRPP Amidotransferase Glutaminase

Name: 14. Guanine normally pairs with cytosine. Oxidative damage can result
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 14. Guanine normally pairs with cytosine. Oxidative damage can result in the modification ofguanine to 8-oxoguanine. What is the potential mismatch in nucleotides that can occurfollowing replication?8-oxoguanine pairs with Adenine8-oxoguanine pairs

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 13TYK

See similar textbooks

Similar questions

Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligase
Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome DNA replication always occurs in the nucleus Eukaryotic DNA replication involves more polymerases than prokaryotic replication.
The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively demonstrated that DNA (a) is a double helix (b) replicates semiconservatively (c) consists of repeating nucleotide subunits (d) has complementary base pairing (e) is always synthesized in the 5 3 direction
DNA replication requires _______. a. DNA polymerase b. nucleotides c. primers d. all are required
DNA double helix does not have which of the following? antiparallel configuration complementary base pairing major and minor grooves uracil
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
Imagine the Meselson and Stahl experiments had supported conservative replication instead of semiconservative replication. What results would you predict to observe after two rounds of replication? Be specific regarding percent distributions of DNA incorporating 15N and 14N in the gradient.
4. During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked. Why does this occur? Option 1a) replication starts at many points on the chromosomeOption 2b) replication can only start at one place on each strand of DNAOption 3c) RNA primers only anneal to one of the parental strands of DNAOption 4d) DNA polymerase III only synthesizes DNA in the 3' - 5' directionOption 5e) DNA polymerase III only synthesizes DNA in the 5' - 3' direction A piece of double-stranded DNA consists of 18 nucleotides. How many codons would the first-formed mRNA transcript have? Option 1a) 18 CodonsOption 2b) 9 CodonsOption 3c) 6 CodonsOption 4d) 3 Codons
23. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices 1. G 2. C 3. A 4. T
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
2. The following represents a DNA strand in the process of replication. The bottom sequence is that of the DNA strand with polarity indicated and the top sequence represents the RNA primer. GGGGCCUUG 5′ TATAACCCCGGAACACTATAC 3′ Which of the following will be the first DNA nucleotide added to the primer? Group of answer choices a. C b. G c. A d. T