DNA to be amplified 5'-GACCTGTGGAAGC 3'-CTGGACACCTTCG CATACGGGATTGA-3' GTATGCCCTAACT-5' primers (1) 5'-GACCTGTGGAAGC-3' (2) 5'-CTGGACACCTTCG-3' (5) 5'-CATACGGGATTGA-3' (6) 5'-GTATGCССТААСТ-3" (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3' (4) 5'-GCTTCCACAGGTC-3' (8) 5'-TCAATCCCGTATG-3' Figure Q8-3 DNA to be amplified and potential PCR primers (Problem 8-12).

DNA to be amplified 5'-GACCTGTGGAAGC 3'-CTGGACACCTTCG CATACGGGATTGA-3' GTATGCCCTAACT-5' primers (1) 5'-GACCTGTGGAAGC-3' (2) 5'-CTGGACACCTTCG-3' (5) 5'-CATACGGGATTGA-3' (6) 5'-GTATGCССТААСТ-3" (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3' (4) 5'-GCTTCCACAGGTC-3' (8) 5'-TCAATCCCGTATG-3' Figure Q8-3 DNA to be amplified and potential PCR primers (Problem 8-12).

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 16TYK

See similar textbooks

Similar questions

Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'
Task A: Polymerase Chain Reaction Master Mix Your first task is to isolate and amplify the NRAS gene from cDNA extracted from different samples through PCR. You will need to run a total of 7 PCRs: 3 normal samples, 3 cancerous samples, and 1 negative control. To make things easier in the lab, when running multiple reactions, the components are prepared not individually, but as a master mix—all the components for multiple reactions are prepared in bulk, except for the template DNA, which is added separately once the master mix has been distributed into individual tubes. The table below lists the different components for PCR, the available stock concentrations of these components, and the needed working concentrations for the PCR itself. Complete the table by supplying the needed volumes of each component for a single reaction and for the master mix (the first row has been filled in as an example).
Preparing plasmid DNA (double stranded, circular) for Sanger sequencing involves annealing a complementary, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90°C and then slowly bringing the temperature down to 25°C. Why does this protocol work? What enzyme is used and what other components are required in the sequencing reaction? How does the Sanger method determine the sequence?
Multiple Matching. Fill in the blanks with the words below that apply.18. ________ site of protein synthesis19. ________ carries the codon20. ________ carries the anticodon21. ________ a process synonymous with mRNA synthesis22. ________ bacteriophages participate in this transfer23. ________ duplication of the DNA molecule24. ________ process in which transcribed DNA code is deciphered into a polypeptide25. ________ involves plasmidsreplicationtRNAconjugationribosometransductionmRNAtranscriptiontransformationtranslationnone of these PreviousNext
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except: a)requires all four ribonucleoside triphosphates and a DNA template. b)can extend an RNA chain and initiate a new chain. c)recognizes specific start signals in DNA. d)produces an RNA polymer that begins with a 5'-triphosphate. e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
Design primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA). The primers should be 15 bases in length. Indicate the 5' and 3' ends of the primers. 5' GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3'
After Heat the mixture to separate mRNA and cDNA strands, and then eliminate the mRNA transcript. The 3’ ends of the cDNA strands loop around and bind by chance to complementary nucleotides within the same strand, forming a “hairpin loop” that serves as the primer for DNA polymerization, what is step 4 of making a cDNA library?