Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 28CTQ
Imagine the Meselson and Stahl experiments had supported conservative replication instead of semiconservative replication. What results would you predict to observe after two rounds of replication? Be specific regarding percent distributions of DNA incorporating 15N and 14N in the gradient.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Suppose that replication is initiated in a medium containing moderately radioactive tritiated thymine. After a few minutes of incubation, the bacteria are transferred to a medium containing highly radioactive tritiated thymidine. Sketch the autoradiographic pattern that would be seen for (a) undirectional replication and (b) bidirectional replication, each from a single origin.
he Meselson and Stahl experiment provided conclusive evidence for the semiconservative replication of DNA in E. coli. What pattern of bands would they have observed in a CsCl gradient after one generation if replication was conservative?
a heavy, a light and an intermediate band
one heavy and one light band (no intermediate)
one intermediate band
one light band
one heavy band
If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
While driving his motorcycle at highway speed, a physics student notices that pulling back lightly on the night...
College Physics
Endospore formation is called (a) _____. It is initiated by (b) _____. Formation of a new cell from an endospor...
Microbiology: An Introduction
4. What five specific threats to biodiversity are described in this chapter? Provide an example of each.
Biology: Life on Earth (11th Edition)
Two parents plan to have three children. What is the probability that the children will be two girls and one bo...
Genetic Analysis: An Integrated Approach (2nd Edition)
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (6th Edition)
Endospore formation is called (a) _____. It is initiated by (b) _____. Formation of a new cell from an endospor...
Microbiology: An Introduction (13th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the Meselson–Stahl experiment, which of the three modes of replication could be ruled out after one round of replication? after two rounds?arrow_forwardWhat are the three models of DNA replication? With the aid of illustrations, show how the Meselson Stahl experiment come to the conclusion of one model of DNA replication. Is DNA replication bidirectional? How did you arrive at this conclusion? Explain the bacterial replication model that supports this conclusion.arrow_forwardYou decide to repeat the Meselson-Stahl experiment, except this time you plan to grow the E. coli cells on light 14N medium for many generations and then transfer them to heavy 15N medium and allow them to grow for 2 additional generations (2 rounds of DNA replication). If the conservative model of DNA replication was correct, what is the expected distribution of DNA in the density gradient after two rounds of replication? Multiple Choice One band of intermediate density. One band of light density. One band of heavy density. One band of light density and one band of heavy density. One band of light density and one band of intermediate density.arrow_forward
- Suppose that 28% of the nucleotides in a DNA moleculeare deoxythymidine 5′- monophosphate, and that duringDNA replication the percentage amounts of availablenucleotide bases are 22% A, 22% C, 28% G, and 28% T.Which base would be depleted first in the replicationprocess?arrow_forwardWhen DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative modelarrow_forwardUsing 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA replication were conservative in one cycle of replication/in three cycles? How aboutdispersive replication in one cycle, in three cycles?arrow_forward
- In the Meselson Stahl experiment differentiating the possible modes of replication, how many rounds of replication were needed to determine that the following modes of replication were not used in E. coli? two rounds of replication for conservative; two rounds of replication for dispersive one round of replication for conservative; two rounds of replication for dispersive two rounds of replication for conservative; one round of replication for dispersive one round of replication for conservative; one round of replication for dispersive none of the above is correctarrow_forwardExplain in not more than 5 sentences. If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do you expect will occur?arrow_forwardIn terms of the new DNA strands that are generated, what are the differences between replication and conventional polymerase chain reaction?arrow_forward
- If DNA replication followed the dispersive model of replication, how would the outcomes of the Meselson-Stahl experiment change? Describe the composition of DNA samples after one and two rounds of replication, and how this is different from the findings of the original experiment.arrow_forwardThe Meselson-Stahl experiment provided strong evidence that DNA replication was conservative, by alternately growing bacteria in medium with heavy 15N and light 14N. If DNA replication were dispersive, what result would Meselson and Stahl have observed after the first round of DNA replication in light nitrogen? Group of answer choices Two bands, one at the location for pure 15N and one at the location for pure 14N. One band, located half way between the locations for pure 15N and pure 14N. Two bands, one at the location for pure 15N and one located halfway between the locations for pure 15N and pure 14N. None of these Three bands, one at the location for pure 15N, one at the location for pure 14N, and one at a location halfway between.arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License