14. Naturally occurring fats are A. L types B. D types C. an equi-molar mixture of L and D types D. Symmetric

Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the GR...

A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and...

Q: What is the purpose of DNA methylation? Why is it ineffective in the DNA repair of spontaneous deami...

A: DNA methylation is the process of adding methyl groups to DNA at Nucleotide bases, so that without c...

Q: In what order would the following proteins eluted from a gel filtration column of Sephadex G200: Myo...

A: Chromatography is a method of separation of specific compound from the mixture of compounds. This ca...

Q: Some mice have a mutation in the liver isozyme of pyruvate kinase leading to an inability to be phos...

A: Pyruvatw kinase in an enzyme which is involved in the glycolysis process. In Glycolysis, the cycle A...

Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number...

A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains car...

Q: 13. Which of the following is an example for derived lipids? A. steroids B. terpenes C. carotenoids ...

A:  Hi! Since you have posted multiple question, we shall answer the first question for as we are only ...

Q: A polypeptide with a net positive charge at physiologic pH (~7.4) most likely contains amino acids w...

A: The pKa values of the side chains of amino acids determine the net charge on a protein at a particul...

Q: Which of the following statements concerning structural characteristics of bile acids is CORRECT? * ...

A: Bile acids are a collection of acidic steroid molecular entities with unusual physical, chemical, an...

Q: In the third video, glucose, glycine and maltose are tested as samples with the Benedict's reagent. ...

A: Introduction: The benedict is used for the detection of simple carbohydrates. It identifies the redu...

Q: Esterase hydrolyzes ester bonds. For simplicity, only the amino acids whose side-chains interact wit...

A: Esterase- group of enzymes which hydrolyses the ester bond from the substrate like acetylcholine, fa...

Q: Show and explain how exactly the condensation reacti of a nitrogen base and sugar results to the Fig...

A: Condensation reaction- It is a type of reaction in which two molecules combined with each other and ...

Q: I. Kwashiorkor, also known as «cdematous malnutrition» because of its association with edema (fluid ...

A: Kwashiorkor or Edematous malnutrition: Kwashiorkor is a protein nutritional disorder associated with...

Q: Which of the following WILL PROMOTE sol formation of neutral polysaccharide sample?   a. place the...

A:  Polysaccharides are used for hydrogel formation nowadays which is diversely used in the field of ti...

Q: Given the following protein: N-MACHKGFDSTRRKYWQNKRLCVSA|IDWQSPWKNQGILV-C The overall charge of this ...

A: (1)The ionizable groups in the given peptide at pH 7 are; N-terminal : it will have +1 charge  Side...

Q: What is the Keq for the conversion of Glucose 6-Phosphate to Glucose 1-Phosphate if the phosphate tr...

A: Given-  1) Potential for Glucose 1-phsophate.- 20.9KJ/mol 2) potential for Glucose 6-Phosphate- -13....

Q: If you have to prepare 4 nM solution of human IgG ( immunoglobuline) which has molecular mass of 150...

A: The number of moles of a solute present in one liter of the solution is called the molarity of that ...

Q: Explain what is happening in point A in terms of the form of Alanine. What is point B? Explain what ...

A: Alanine is an Amino acid which consists of 2 acidic groups. Hence it is considered as diprotic Amino...

Q: Km value of an enzyme

A: here they are talking about enzyme kinematics. The value of Km, app grows as the inhibitor concentra...

Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...

A: Pyruvate carboxylase (PC) is a ligase class enzyme which catalyze the irreversible carboxylation of ...

Q: Name the following nucleotide: HN P-0-P-0-CH2 OH

A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and Ribonucle...

Q: What characteristic makes each amino acid unique from one another?

A: Amino acids are organic compounds with functional group namely carboxyl and amino. There are 20 amin...

Q: Aspirin reduces inflammation and prevent platelet aggregation by inhibiting the formation of which o...

A: Aspirin is nonsteroidal anti-inflammatory drug (NSAID) used to treat pain and inflammation. Aspirin ...

Q: ACTIVITY 7.2.2 Show and explain how exactly the condensation reaction to form a nucleotide happens. ...

A: Nucleotides are the phosphoric acid esters of nucleosides with the phosphate group. Nucleotides are ...

Q: What assay could be used to test the function of a protein in the glycoside hydrolase family?

A: Glycoside hydrolases are enzymes that catalyze the hydrolysis of the glycosidic linkage of glycoside...

Q: Consider three groups of solutes: (i) steroid hormones, fatty acids,and other lipids; (ii) inorganic...

A: The function of cell membranes is to organize and protect cells. The outer plasma membrane of every ...

Q: 2. Draw the structure of the tripeptide Gly-Ala-Tyr H H. N-C-C H N-C-C + N-C-C + H он он CH3 H. 0-H ...

A:             Proteins have four levels of structural organization including Primary, secondary, terti...

Q: What are the other methods of detection for blood glucose determination? Explain the principle invol...

A: There are different methods for estimating the levels of glucose in the blood. The different methods...

Q: Q1: Explain the effect of pH value on the amino acid ionization. Q2: Describe two reactions for amin...

A: Amino acids and their ionization: Amino acids are the basic building blocks of proteins, they are bi...

Q: 1. A sigmoidal plot of substrate concentration ([S]) verses reaction velocity (V) may indicate: (A) ...

A: Hi. Thank you for the question. As per the honor code, We are allowed to answer three sub-parts at a...

Q: Can a chemical reaction takes place without the application of enzyme or catalyst? Why or why not?

A: Introduction:  A chemical reaction is a change in which one or more substances undergo conversion to...

Q: The interior core of globular proteins is typically composed of non-polar amino acid residues becaus...

A: Proteins are made up of polypeptide chains of amino acids. The amino acids arrange themselves to for...

Q: Label all 5 the indicted regions in this coenzyme (labels like site of  redox activity, etc)

A: Coenzyme are  molecules which enhances or facilitates the action of specific enzyme. Enzymes are usu...

Q: Which of the following statements are TRUE?   Multiple answers:Multiple answers are accepted for thi...

A: In given Questions many statement given about glycolysis cycle.Glycolysis is the metabolic pathway t...

Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by

A: Glycoproteins are molecules that comprise protein and carbohydrate chains that are involved in many ...

Q: In generating CO2, how can the citric acid cycle discriminate between the carbons in citrate given t...

A: In the first phase of the cycle, acetyl CoA combines with oxaloacetate, a four-carbon acceptor molec...

Q: Which class of proteins is more easily denatured—fibrous or globular?

A: In an amino acid-chain molecule, protein structure refers to the three-dimensional arrangement of at...

Q: Dietary fats are transported as _____.

A: Fats are the combination of both fatty acids and glycerol, these are categorized into lipids. Three ...

Q: What chemical test could be used to differentiate a protein from an amino acid? Explain briefl

A: Introduction: Amino acids are biological molecules that contain an amine and a carboxylic group and ...

Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions ...

A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have...

Q: Are there any research involving white vinegar that it is effective as an ingredient in making insec...

A: Vinegar is an aqueous solution of acetic acid and trace compounds, which may or may not contain flav...

Q: (Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would...

A:            The process of translation takes place in the cytoplasm which converts mRNA to protein/en...

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...

A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...

Q: Draw the Fischer projection formula for each sugar and give the importance/use of each. 1. D- glycer...

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since ...

Q: Directionality of Polynucleotide chains originates at the  ____ end, and terminates at the  _____ en...

A:

Q: 1. The overall charge of this protein at pH 7 is Drop-down answer choices are [positive, negative, o...

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...

Q: Answer choices are provided below for drop-down questions. 1. The overall charge of this protein at...

A: Since you have asked multiple questions and haven't specified which has to be answered. Therefore, a...

Q: 25. What would be the new pH of a 1L buffer solution (pH=7.8) upon the addition of 3mL O.0001 M HCI....

A: The new pH of a 1L buffer solution (pH=7.8) upon the addition of 3mL 0.0001 M HCI. (Buffer, pka=7.2)...

Q: 17/18 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby o...

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since yo...

Q: Kinesin-1 was the first member of the kinesin superfamily to be identified and therefore is perhaps ...

A: Kinesin are one of the mejor cytoplasmic motors responsible for long range transport in all eukaryot...

Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid ...

A: There are twenty naturally occurring amino acids that form proteins in biological systems.