16. Nitrogen bases pair with bases that are O available identical complimentary O opposite

Q: Determine if the cells in telophase I of meiosis are haploid or diploid.

A: Telophase I is a phase observed in the process called meiosis. Meiosis or reductional division is…

Q: The parents in the family above produce another son, this time with two Y chromosomes and normal…

A: 1. We all know that for male progeny to occur in human is that it gets its X chromosome from his…

Q: identical in all EVOLUTION LINK The reactions of glycolysis are organisms-prokaryotes, protists,…

A: Cellular respiration is a metabolic process that takes place inside the cell resulting in usage of…

Q: Plz answer this all questions    What muscle in the shark is homologous with the geniohyoideus in…

A: The common mudpuppy is a species of the salamander belongs to the genus Necturus. They live an…

Q: arrived from the mainland 100 years (at least 50 generations) ago on been little or no gene flow…

A: Many of the hypothese regarding the genetics of adaptation require that one know specific details…

Q: Why do we compare allometric relationships with a line of unity?

A: The allometric relationship is the relationship of body characteristics like anatomy, Physiology…

Q: 22. VIRAMUNE Oral Suspension contains 1% w/v of nevirapine. Calculate the milli- grams of nevirapine…

A: VIRAMUNE: Nevirapine (NVP), marketed among other names as Viramune, is a drug intended to treat and…

Q: Which of the following is an illustration of experience-dependent plasticity? A) Rats raised in…

A: Introduction- experiences can profoundly shape the structure and function of the brain. This…

Q: - Solve the following genetic problems with a Punnett square 1. An organism that shows a dominant…

A: Introduction :  Genotypenis defined as the genetic information passed down from one generation to…

Q: Why is it essential to balance your 400 mL of cell culture before centrifuging?

A: Ans: A centrifuge is a machine which use centrifugal force to separate the components of a mixture.…

Q: This is affected by things like v enzymes, including collagenase, that are released from the…

A: Bacteria constitue large number of unicelluler organisms. These are mostly belong to kingdom…

Q: How can this fusion be done? Can something be done using tissue engineering and 3D printers? What…

A: 3D printing:  The process where the biomedical structure in a three-dimensional form can be printed…

Q: The brain is particularly sensitive to being shaped by input from the environment during sensitive…

A: Developmental psychology is a discipline of psychology that is concerned with the processes and…

Q: Ⓒ Macmillan Learning There are many examples of species that were ancestral to or closely related to…

A: The blanks can be filled with the following suitable options.  Dark blue(bottom most) -…

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: F. How much of a 100 mg/mL stock of Ampicillin would you need to add to 400 mL for a 100 ug/mL final…

A: Given data:-  Concentration of stock of ampicillin = C1 100mg/ml. Volume of stock solution required…

Q: 1. Chicken Human Mouse Lancelet Zebrafish Frog Drosophila a. Which lineage of vertebrates shows the…

A: Phylogenetic tree is a diagrammatic illustration which determines how taxons are related to each…

Q: Genetic drift: is variation in the relative frequency of different genotypes in a small population,…

A: Genetic drift It is mechanism of evolution, responsible for random changes in the gene pool. It…

Q: Vitamin list: Vitamins may be used more than once  Thiamin Folate  Riboflavin Vitamin B12  Niacin…

A:

Q: A mutation that results in a premature (early) stop codon, will terminate transcription resulting in…

A: Transcription is a process by which mRNA is made by rna polymerase using dna as a template.  When…

Q: Suppose you have a drug that specifically inhibits telomerase. You administer the drug to mice.…

A: Introduction :-   A significant ribonucleoprotein complex called telomerase is in charge of…

Q: what are the goup of muscles that is working to allow a hip flexion in a squat?

A: Introduction  Squats are a complex exercise. They therefore engage a number of lower body muscle…

Q: Considering the anatomy of reptiles and amphibians explain the difference between these two 2…

A: Reptiles and amphibians are the important organisms under the animal kingdom. They are tetrapods…

Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…

A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…

Q: In  gel electrophoresis and column chromatography, why do large molecules migrate more easily in one…

A: Gel electrophoresis is the separation technique used to separate molecules based on their charge and…

Q: How does the intake of Caffeine cause disruption in deep in older people?   Please provide the…

A: Answer  Using caffine by old people can cause disruptive sleep. The stimulant's most evident side…

Q: A histological specimen of submandibular salivary gland represents basket * cells from which some…

A: Introduction :- Saliva is produced by salivary glands and maintains strong teeth while also…

Q: Which of the following blood-related activities is not controlled by the endocrine system? Multiple…

A: Ans - Third answer of first image. Endocrine system do not produce hormones that asist in blood cell…

Q: Which of the following is the best definition of a molecular marker? a gene that is likely to be…

A: a molecular marker  is a fragment of DNA that is associated with a certain location within the…

Q: Choose all the answers that apply. Where are osteoprogenitor (osteogenic) cells found?…

A: Introduction: Osteoprogenitor cells, sometimes termed to as osteogenic cells, are stem cells that…

Q: How does intercellular co2 (Ci) relate to photosynthesis? Does more light increase or decrease…

A: Photosynthesis is a process in which plants use carbon dioxide, water and sunlight to synthesize…

Q: Hydromorphone hydrochloride supposi- tories contain 3 mg of active ingredient and weigh…

A: 39. Given, hydromorphone hydrochloride suppositories contain : Active ingredient = 3mg, and  Total…

Q: How do cats drink?

A: Answer : Cats drink water by what we call cat's lapping stratigy.Water stuck to the tip of a cat's…

Q: Demonstration of Osmosis using Potato Osmoter 1. Where was the liquid cavities of some of the…

A: Introduction: The osmosis phenomena in living plant cells is demonstrated using a potato osmometer.…

Q: In a saliva of the patient the contents of enzymes is reduced. What cells of secretory portion do…

A: Salivary glands are made up of secretory units also known as acini and ducts. Ducts are highly…

Q: Determine if the cells in prophase II of meiosis are haploid or diploid.

A: Mitosis and meiosis are two kinds of cell division that occur to form daughter cells. Mitosis occurs…

Q: Acetylcholine is a neurotransmitter that, when bound to its receptor, causes the receptor to open a…

A: Introduction:- Neurotransmitters are the chemical signalling molecules which helps in the…

Q: 3d bioprinting systems, biomaterials, tissue engineering. Find a creative project topic on the…

A: Tissue engineering is a highly sophisticated and modern technique that is utilized in today's world…

Q: Digestion of the macronutrients begins in different parts of the GI tract. Apply what you have…

A: In the process of digestion large macro molecules are broken down into smaller units.

Q: The genomes of two E. coli strains are compared in Figure 14-19. Would you expect any third strain…

A: The availability of this genome sequence will aid in the identification of genes responsible for…

Q: what is the qualitative anatomical analysis of a squat active

A: A basic human movement that may be seen in almost all facets of life is the squat. In addition, it…

Q: Why are onion root tips and whitefish blastula used to study mitosis?

A: Cell division is a phenomenon in which parent cells undergo splitting and give rise to new cells. So…

Q: E. coli BL21 cells carrying a pQE expression vector can be induced to produce large amounts of a…

A: Ans is f - glucose, E. coli BL21 Cells carrying a PQE expression vector can be induced by adding…

Q: What is predator management? What is the linkage between the evolution of prey and predator species…

A: 1) Predator management is a strategy used in wildlife management that aims to control the numbers of…

Q: The graph shows the rate of transpiration (Est) for four plant species. Nothofagus dombeyi was the…

A: N.dombeyi at mid day in summer, suggesting reversible reduction in photochemical efficiency of…

Q: Which of the following gene regulatory molecules act in trans. Check all that apply. The lac…

A: Introduction:- The gene regulatory molecules helps in regulating the expression of different genes,…

Q: Considering the values in the following table, what relationship can be observed between the amount…

A: WATER POTENTIAL - Water potential is the amount of energy needed to move an infinitesimally small…

Q: Macmillan Learning There are many examples of species that were ancestral to or closely related to…

A: Australopithecus afarensis existed between 3.9 to 2.9 million years ago(mya). So, the first blank…

Q: Some friends are trying to make wine in their basement. They've added yeast (which is a facultative…

A: Introduction  The metabolic process of fermentation involves the action of enzymes to cause chemical…

Q: Indentify the correct food web for each question. Which type of food web cycles materials and moves…

A: INTRODUCTION Food chain : it explains who eats whome in a wild. This helps to the flow of energy and…