2. An mRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the above-mentioned mRNA sequence. (Do not forget to read the sequence from 5' to 3' direction while decoding the transcript) 3'- a) What would be the
Q: What is the etymology of the plant species podocarpus costalis (C.Presl)? I need complete answers…
A: The podocarpus costalis plant is native to central and southern China. The genus name Podocarpus is…
Q: Which of the following is NOT a function of vitamin C? A. Blood clotting B. Enhances the immune…
A: Biological molecules are the molecules that are required by the body in enough amount for proper…
Q: Sodium is the most abundant mineral in the human body? A. True B. False
A: Our bodies require a number of different nutrients, in varying quantities, for proper functioning.…
Q: Give a brief note on Oral Contraceptives ? Answer should include all pharmacological studies,…
A: The term pharmacology is associated with the study of how medications affect biological systems. It…
Q: Choose at least 2 organisms (1 plant and 1 animal) that can only be found in the Philippines.…
A: Taxonomic classification: It is the order of grouping organisms (plants and animals) in different…
Q: What is the significance of meiosis?
A: The following is the significance of meiosis:
Q: why it is essential to understand the chemical composition of plants?
A: A plant is a living organism that typically synthesizes its own food from inorganic matter by…
Q: Assume the energy of hydrogen bonds per base pair solution at 319 K. ratio - 283
A: 9.8.2016 Cresawn BIO 140 The Chemistry of Life I. Ionic Bonds a. So different, that electrons are…
Q: Which phase in the generation of action potential is represented by N? +30 M N K -55 -70 Time…
A: Whenever a neuron is triggered by a stimulus, it experiences a brief shift in electrical potential…
Q: 1. Fill in the blanks in the table below regarding the similarities and differences between two…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: 2- Experimental Procedure 1- Plate cells into 96-well tissue culture plates. In general, 5000-10,000…
A:
Q: Fat has minimal thermic effect compared to carbohydrate and protein? A. True B. False
A: Answer True
Q: There are a couple look-alike plants in the Alberta area. Explain how you can differentiate each of…
A: Rosa acicularis and Rosa woodsii 1 to 10 (typically 2 to 4) flowers at the tips of new lateral…
Q: Pedigree 3: NOTE: the asterisk (*) indicates that the individual does not have any disease-related…
A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is…
Q: Are current exposures bisphenol A enough to be a concern to human health
A: BPA is bisphenol A, it is chemical compound which is produced by the condensation of phenol and…
Q: MEDICAL TERM MAIN ENTRY (pronunciation) MEANING (definition) 1. dermis 2. sublingual 3. paronychia…
A: Medical terms : The three major parts to medical terms are a word root that generally is the middle…
Q: Why is it important to know the evolutionary relationships between organisms? Explain briefly
A: According to theory of organic evolution, the present day forms of life are modified but are…
Q: 1. In making genetic crosses, why is it important to identify the gametes that each individual can…
A: There are few important points that should be kept in mind : As we know that genetics deals with…
Q: Which of the following protein domains would you expect to find in an "easily druggable" target but…
A: Answer :- Option (E) is correct.
Q: The table below shows the num of Individuals from 4 species of ground beetles sampled in a forest.…
A: Shannon index basically talks about the species abundance and and their richness. It can take…
Q: Red blood cells carry oxygen by directly binding to the oxygen molecule through? A. Hemoglobin B.…
A: Haemoglobin : Its is the protein molecule that carries oxygen as well as carbon di-oxide in the…
Q: Is it more correct to describe a mushroom as haploid, diploid, both or neither? Explain.
A: Mushroom: A mushroom, often known as a toadstool, is a fungus' fleshy, spore-bearing fruiting body…
Q: Explain the metabolic changes found in denitrifiers, compared to microorganisms doing aerobic…
A:
Q: What is the procedure of controlling the opening and closing of the stomatal pores?
A: Introduction Stomata are cell structures in the epidermis of tree leaves and needles that allow a…
Q: Free radical has been highly linked to cancer because it damages? A. DNA B. Mitochondria C. Cell…
A: Free radicals are unstable atoms that can cause cell damage, resulting in illness and aging. Free…
Q: Which of the following is not a possible outcome of changing the epigenetic code? a) exposure of…
A: * Epigenetic code is an defining code in eukaryotic cells in which each cell consist specific…
Q: Suppose a region of DNA is 100 bp long. How many unique sequences could it potentially represent?…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms that contain specific…
Q: Genes with highly similar sequence are often located adjacent one another in the genome. Gene…
A: The physical unit of heredity can be called the gene. The term inversion is associated with a…
Q: Explain the plant cell as an osmotic system.
A: Osmosis the process where solvents moves from its high cencentration to low concenrration through…
Q: Examine the graph in figure 4, write a essay analyzing the data to explain how dams impacted genetic…
A: At the species, genomic, community, and ecological levels, human activities have an impact on…
Q: What are homologous chromosomes? What happens to homologous chromosomes during meiosis?
A: Meiosis is reductional division. Mitosis is equational division.
Q: Describe in detail photosynthesis as a redox process. What gets oxidized? What gets reduced?
A: Plants make use of sunlight, carbon dioxide and water to produce glucose and oxygen. This is aided…
Q: True or false: Neurotransmitter binding to a single GPCR can only activate a single G-protein. O…
A: G Protein-coupled receptors (GPCRs), also known as seven-transmembrane domains receptors, are a…
Q: Draw the image below, which also shows the result of opening the uterine horn, revealing the…
A: An embryo develops to form fetus and an embryo is formed by the fusion of male and female gametes.…
Q: 1. Lab 42 1st Male Torso Models
A:
Q: What condition is shown in the diagram? Explain how the body regulate this process.
A: The homeothermic animals always maintain a constant core body temperature. They have homeostasis…
Q: What information can one get from solving simple monohybrid and dihybrid crosses? How do we apply…
A: To understand how genes work and how specific features are acquired from parents and grand parents,…
Q: Complete the medical term from its meaning and word parts given: 11. inflammation of a tendon: 12.…
A: Introduction The disorder is an illness that disrupts normal physical or mental functions. it is is…
Q: Describe any problems or any benefits associated with polycladida worms.
A: Polycladida can be referred to as the order containing a group of flatworms with a wide range of…
Q: Given the sources of evidence, explain precisely how it supports evolution. C. Homologous Structure
A: Homologous structures are structures that have the same evolutionary origin. They may or may not…
Q: Describe the hypothesis of pressure flow for the transportation of sugars in the plants.
A: In Plants, the mechanism explained for the translocation of sugars from source to sink is referred…
Q: In the context of ecological succession, classify cach example as facilitation, inhibition, or…
A: Introduction Ecological succession is the process by which the structure of a biological community…
Q: the healthcare concerns, infections, and nosocomial infections discussed for genera Streptococcus?
A: The healthcare concerns, infections, and nosocomial infections for genera Streptococcus.
Q: Domain: Domain: Kingdom: Phylum: Kingdom: Phylum: Class: Class: Order: Order: Family: Family: Genus:…
A: Introduction A taxonomy is a hierarchical scheme for classifying and identifying organisms to…
Q: Autophagy is an evolutionary conserved catabolic process devoted to the degradation of intracellular…
A: Introduction : Autophagy is the natural process of break down and destroying old , damaged cells…
Q: please label the internal of snail in the photos
A: Kingdom : Animalia Phylum : Mollusca Class :…
Q: Differentiate transcription in both prokaryotic and eukaryotic cells. 2.Discuss the encoding of…
A: Prokaryotes have simple cellular organisation with no nucleus and membrane bound organelles where as…
Q: Why does pure water have maximum water potential?
A: Water potential of pure water :-
Q: Ways in which a resistant form of infectious disease can re-emerge include A when the vectors are…
A: Resistance to antibiotics is a normal occurrence. Antibiotic resistance, on the other hand, is…
Q: Is there a difference between the initial and the final energy levels in catalyzed and non-catalyzed…
A: The answer is NO.
Step by step
Solved in 2 steps
- 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
- 1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A. 5’-CGU-UAC-AGG-CCA-3’ B. 3’-CGU-UAC-AGG-CCA-5’ C. 5’-CGT-TAC-TGG-GCA-3’ D. 3’-CGT-TAC-TGG-GCA-5’ 2. Which is the correct amino acids using the mRNA strand of 5’-AUG-CAU-CAA-3’? A. MET-HIS-GLN B. GLN-HIS-MET C. MET-GLN-HIS D. HIS-MET-GLN7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
- 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand in mRNA. Label the 5’ and 3’ ends. Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.1. Which of the following statements about mRNA is correct?a. Eukaryotic mRNA is generally polycistronic while prokaryotic mRNA is monocistronic.b. Both prokaryotic and eukaryotic RNA is polycistronic.c. Both prokaryotic and eukaryotic RNA is monocistronic.d. Eukaryotic mRNA is generally monocistronic while prokaryotic mRNA is polycistronic. 2. Which of the following statements about leading and lagging strand synthesis is correct?a. The lagging strand can only be synthesized once the leading strand has been completedb. Lagging strand is synthesized is continuously while leading strand is synthesized fragment by fragment.c. Leading strand is synthesized is continuously while lagging strand is synthesized fragment by fragment.d. Okazaki fragments are used to synthesize the leading and lagging strands of DNA. 3. An intron of a gene had a G to T mutation on the 3’ splice site. What will happento this intron?a. The intron will not be spliced out but will not be recognized in the ribosome…
- 4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?3. The sequence of bases on an mRNA strand is AAUCGACGCCCGACUAGC. List the codons present in this sequence. 4. List the tRNA anticodons that would pair with the codons present in the above sequence of mRNA. 5. Determine the translated amino acid sequence obtained from the mRNA strand given in question 3. You may use the genetic code table to translate. 6. A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce the codon that will bind it to this anticodon. 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA. 8. Describe all the elements required to carry out the process of translation. 9. Describe the importance of DNA in determining the structure of a particular protein.