Answered: mini mRNA has the sequence…

Name: 4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3.a)
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3.a) Using the genetic code, provide the amino acids specified by the mini mRNA.b) Label the two ends of the short peptide.

Science

Biology

mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 7RQ: Which subunit of the E. coli polymerase confers specificity to transcription? a. b. c. d.

See similar textbooks

Similar questions

1. a)What are the two types of ncRNA used in translation? b.) How is translation terminated when the ribosome reaches a stop codon?
1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the functional mRNA? b.) what is the sequence of the 25th codon? c.) what is the sequence of the stop codon? 2. If the mRNA transcribed for this gene will be translated into a functional protein, a.) how many amino acids will be used to build the polypeptide chain? b.) what is the amino acid coded by the 25th codon? c.) what is the amino acid coded by the last codon? 3. If the above gene is one of the three structural genes of the lac operon that codes for the protein/ enzyme responsible for breaking lactose into two molecules of simple sugars, a.) what triggers the activation of this gene? b.) what triggers the inactivation of this gene? c.) what substance is attached to the operator region of the operon in the absence of activator? d.) what gene is responsible for the synthesis of the substance used to attach in the operator region in the absence of activator? e.) what…
1. If the gene above is transcribed into a functional mRNA,a.) how many codons will be carried by the functional mRNA?b.) what is the sequence of the 25th codon?c.) what is the sequence of the stop codon?2. If the mRNA transcribed for this gene will be translated into a functional protein,a.) how many amino acids will be used to build the polypeptide chain?b.) what is the amino acid coded by the 25th codon?c.) what is the amino acid coded by the last codon?
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C. MRDMW-
Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'
: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
Which subunit of the E. coli polymerase confers specificity to transcription? a. b. c. d.