3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand in mRNA. Label the 5’ and 3’ ends. Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.

3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand in mRNA. Label the 5’ and 3’ ends. Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Related questions

Q: 3. (i) Referring to the genetic code (the codon usage table), what would be the amino acid sequence…

A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…

A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What…

A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. During…

A: Translation, in molecular biology and genetics, is the mechanism by which ribosomes in the cytoplasm…

Q: Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…

A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…

A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: A sequence of nucleotides in a DNA strand—5′-ttAACggCttttttC-3′— was used as a template to…

A: A template strand is the strand of the DNA that is also called a non-coding strand. By complementary…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: An mRNA has a sequence 3'-AAAUUACUCGAAAUUGCGUGUAGU5'. a) What would be the DNA, t-RNA and amino acid…

A: Points to know : The fundamental process of protein synthesis is the formation of peptide bond…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…

A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…

Q: Here is a DNA sequence that codes for an extremely short protein. 3' TТАССТССССАТССАА 5' template…

A: DNA acts as the template for mRNA synthesis. The mRNA has the same sequence as the coding strand of…

Q: 3. Using your Genetic Code, translate and group the following MRNA bases. Example: UAC CAG UGG UUU…

A: a. 5 'CUC GGU ACG UAA UAG AUC UAU CAU CCG AGA CUC UUA AAU 3' ANSWER: 5' Leu Gly Thr Stop Stop Ile…

Q: Given a non-template strand with this sequence: 3'- G CATCGCTAGCGGCTAGA-5' What will be the sequence…

A: The Maij difference between DNA and RNA is that DNA have bases A, T, G ,C where as RNA has A,U,G,C.…

Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…

A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…

Q: MRNA 20 ORI 40 - FTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGHAATATOGGGATGCACTATC…

A: Gene expression includes transcription and translation. It leads to synthesize mRNA and protein…

Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.

A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…

Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…

A: DNA is the genetic material present in our body and RNA encodes for protein molecules. DNA and RNA…

Q: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate…

A: Given: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’.

Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5'…

A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to…

Q: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming…

A: Hello! According to guidelines we have to answer the first 3 sub-parts only. so please kingly post…

Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…

A: The process of copying the information in a strand of DNA to produce an mRNA is called…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…

A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…

Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…

A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…

Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…

A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…

Q: A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid…

A: Introduction Genetic code or codon is a three nucleotide sequence present on mRNA. It gives the…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…

A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…

A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…

Q: TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one…

A: The template strand of DNA serves as a template for synthesis of a complementary RNA transcript. The…

Q: What is the sequence of the mRNA transcript that will be produced from the following sequence of…

A: Transcription is the process of synthesis of RNA from DNA. RNA polymerase catalyzes this process by…

Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L

A: Dear student answer of your question is given below: Given codon in the mRNA is 5' GAA 3' , It…

Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…

A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which…

A: According to the central dogma of life, DNA replicates to form copies of itself. DNA acts as a…

Q: The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase…

A: DNA and RNA are the biomolecules that make up the part of our genetic material. DNA is the genetic…

Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…

A: AAG ATA CAG GCT CGG TAA : DNA

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: 1. DNA- GTATACCAGTCATTTGTC mRNA- CAU AUG GUC AGU AAA CAG Amino acids - His- Met-Val-Ser-Lys-Gln

Q: 6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA-…

A: For the expression of a gene, the nucleotide sequences present in the template strand of DNA are…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…

Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…

A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…

Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…

A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…

Q: Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation…

A: The start codon for eukaryotes is methionine. There are different initiation codons for different…

Question

3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’

5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’

Copy the template strand in mRNA. Label the 5’ and 3’ ends.

Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’Write: b) the sequence of the corresponding segment of mRNA formed using the DNA segment above as the template
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
1. What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’? 2. In what direction does a polymerase move when synthesizing a strand of mRNA? 3. Define transcription and translation. Which process occurs first to make protein from DNA?
1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are the tRNA anticodons of the mRNA codons from item 1? 3. What is the complementary DNA strand of the mRNA strand from item no 1? 4. The DNA strand from item 3 undergoes replication. What will be its complementary DNA strand?
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.