2. Calculate the energy released by the burning, or oxidation, of 1 g of glucose, C6H12O6 (Figure 11). T/ [ans: 15 kJ/g]
Q: Disruption of which process will have the greatest impact on the number of electron carriers used by…
A: Disruption of which process will have the greatest impact on the number of electron carriers used by…
Q: Zoey Wong is a research officer at the Department of Biosciences of Tunku Abdul Rahman University…
A: The basic principles of the central dogma of molecular biology is similar in both prokaryotic and…
Q: Inhibitors for this reverse transcriptase fall in two classes: nucleoside analog inhibitors (NRTIs)…
A: Reverse transcriptase is an enzyme that synthesizes DNA from RNA. Reverse transcriptase catalyzes…
Q: The enzymatic activity of PFK1 is generally measured by set- ting up a coupled enzyme assay system…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: Please help me with finding the hypotheses that are being testing in each of the three enzyme…
A: Starch is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: What is the property/characteristics of DNA that makes it insoluble to ethanol/isopropyl alcohol?
A: The mechanical separation of the nuclear contents from the remainder of the cell, accomplished by…
Q: There are some cells in our bodies (stem cells) that are able to form new structures even in adults.…
A: Stem cells are undifferentiated cells In our body that can turn into any specific cells, as per the…
Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its…
A: Pyruvate under Aerobic conditions: Pyruvate can diffuse into mitochondria under aerobic conditions,…
Q: If you wanted to improve the catalytic efficiency of an enzyme, would you mutate amino acid residues…
A: In the transition state, a molecule is neither a substrate nor a product. This state exists at the…
Q: For paper chromatography, the obtained Rf value of an amino acid with uncharged nonpolar R group is…
A: Chromatography is performed to separate a mixture of closely related substances. Paper…
Q: 1. Consider the following: a) Name it. b) Using the three-letter symbols for the amino acids, how…
A: Peptides are composed of twenty standard amino acids. These twenty standard amino acids differ from…
Q: 1. Calculate the initial velocity (Vo) of a Michaelis-Menten reaction as a fraction of Vmax when [S]…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: A. STARCH TUBE A B C HYDROLYSIS OF CARBOHYDRATES Treatment HCI, heat H₂O, heat RT, H₂O Benedict's…
A: Starch is a polysaccharide and sucrose is a disaccharide. Starch is also known as plant storage…
Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…
A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…
Q: What will be the result for each qualitative test if the intact casein contains the following…
A: Protein qualitative tests are test used to estimate the proteins qualitative way, i.e. it identifies…
Q: How can RNA sequencing (RNA-Seq) and microarrays in Transcriptome analysis find disease genes?
A: Researchers can describe the transcriptional activity (coding and non-coding), concentrate on a…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: QUESTION 5 Oxaloacetate Acetyl-CoA AG" = -7.7 kcal/mol COA Citrate Fatty acids AG"=-1.5 kcal/mol…
A: Free energy change (∆G) of a reaction helps to find the spontaneity of a reaction. Negative ∆G of a…
Q: Which of the following statements is/are FALSE about Bradford assay? 1. Upon addition of the…
A: Bradford Assay is an accurate spectroscopic analytical method to measure the concentration of total…
Q: What is the purpose of inverting (or siding up) an inoculated plate when we place it inside…
A: The incubator is used for the incubation of Petri plates. Petri plates are used to grow the…
Q: C. TBARS Assay 1. In a test tube, mix 1 mL of the samples and 1 mL of thiobarbituric acid reagent.…
A: Sources of error can be defined as the factors which affect the accuracy and precision of an assay.…
Q: Identify the enzyme involved in this reaction from the Krebs cycle. COO CH₂ CH₂ Coo FAD O isocitrate…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Proteins form plant sources are Always complete dietary protein Seldom complete dietary protein It…
A: Proteins are substantial, intricate molecules that are essential to numerous bodily processes. They…
Q: why is having a more reductive environment will alter the functional characteristics of alpha…
A: Keratin is a protein that is of two types: alpha and beta keratin. Alpha keratin is alpha helix…
Q: Cholesterol Synthesis and Metabolism Q6.2: Describe the TWO major discoveries from the Goldstein…
A: Cholesterol is a type of lipids or modified sterols which is a vital component of cell membrane and…
Q: Which of the following statement is FALSE about enzymes? Enzymes are unconsumed during a biochemical…
A: Enzymes are biological catalysts that are utilized by metabolic reactions occurring in the living…
Q: The Hb Yakima variation is caused by the mutation D99H, which results in a shift in oxygen binding…
A: Hemoglobin binds to oxygen and it appears in two state. The T state (tensed) and R state (relaxed).…
Q: Why is a protein's structure important? What can happen if there are any changes? Provide an example…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: Mutual intermediates of catabolism of proteins, carbohydrates and lipids; their role in the…
A: Catabolism is the process of breaking down of complex compounds into simple molecules. The catabolic…
Q: Which of the following laws of matter best describes the statements on sulfide minerals? Select one:…
A: INTRODUCTION : Sulfide minerals - They are a class of minerals consisting of sulfide or disulfide…
Q: Hair is comprised largely of keratin, a fibrous protein consisting of two a-helices wrapped around…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: 3. Use the structure shown below to answer the questions that follow: a b C. bottom. CH₂OH OH ) Name…
A: Carbohydrates are the important bio molecules that provide energy for the living organisms.…
Q: Yeast cells are grown with galactose as the sole carbon source and ATP levels are abundant. Describe…
A: GAL genes: The GAL genes, which include structural (GAL1, GAL10, GAL2, and GAL7) and regulatory…
Q: Suggest a curve illustrating the logD of amphetamine as a function of pH (from pH 1 - 14).
A: LogD is a distribution constant used to define the lipophilicity of a drug. LogD gives more accurate…
Q: Match the following experimental methods with their specialty procedures and objectives.…
A: There are experimental methods that are used in biological processes. Autoradiography, the use of…
Q: Fumerase is an enzyme in the citric acid cycle that catalyzes the conversion of fumerate to…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: 5. (a) Hexokinase IV is known as glucokinase (GCK) and is a central metabolic enzyme that…
A: Hexokinases: An enzyme that phosphorylates hexoses (six-carbon sugars) to produce hexose phosphate.…
Q: The question of differentiation. How can a single cell the fertilized egg generate so many different…
A: Introduction Fertilization is a process by which male and female gametes combines to form zygote.…
Q: Consider the following reaction occurring at 298 K: OH CH₂OH OH -0. OH +ATP OH k₁ k₂ 0- -0-CH₂ to OH…
A: Biochemical reactions tend to be slow because biomolecules are stable at biological pH and…
Q: A patient weighing 38.4 pounds presents with a bacterial infection and is prescribed a course of…
A: A multitude of bacterial infections can be treated with the antibiotic amoxicillin. These include…
Q: The PI of protein P is 7.3. One can purify protein P by:
A: The proteins are composed of twenty naturally occurring amino acids that are linked vis peptide…
Q: To get all of the amino acids out of the oligopeptide below and into the bloodstream through the…
A: Oligopeptide: Any of the enzymes in the family of proteolytic enzymes, commonly known as proteases,…
Q: Recall that vmax is achieved only at high substrate concentrations. Do you predict that vmax will…
A: Enzyme kinetics is the study of enzyme reactions rates and the conditions which affect them. Enzyme…
Q: Answer in brief sentences in your own words please thank you! 1. Soon after the bolus reaches the…
A: Starch is a complex carbohydrate. Starch digestion starts in the mouth but occurs mostly in the…
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting linoleic acid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Identify the following structures in a DNA molecule:
A: The four types of biological macromolecules are nucleic acids, proteins, lipids and carbohydrates.…
Q: Many proteins that remain homogeneously distributed in water have molecular masses in the range of…
A: A colloid is a heterogeneous mixture in which the dispersed particles are intermediate in size…
Q: Which of the following statements involving the properties of matter (physical or chemical) does NOT…
A: INTRODUCTION : Amylase - It is an enzyme that catalyses the reaction of hydrolysis of starch into…
Q: Which statement is false for transition-state analog enzyme inhibitors? They fit the active site…
A: Transition state analogues are used as enzyme inhibitors. They bind competitively to the active site…
Q: (Multiple coenzymes on the left may match to the same reaction on the right. Some reactions on the…
A: Co enzymes are the molecules that help in accelerating the reaction rate or helping the enzyme to…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A slice of pizza has 500 kcal. If we could burn the pizza and useall the heat to warm a 50-L container of cold water, what wouldbe the approximate increase in the temperature of the water?(Note: A liter of cold water weighs about 1 kg.)(A) 50°C (B) 5°C(C) 100°C (D) 10°COxygen i n the atmosphere exist in the diatomic form, what will happen if it exist in monoatomic form?Determine the number of atoms in 30.0 g of P, with the correct amount of sig figs.
- Compare the average N–O bond in NO3– to the average N–O bonds in NO2+ and NO2– (from above). Rank the three N–O bonds from weakest to strongest and from shortest to longest.What coefficients must be placed in the following blanks sothat all atoms are accounted for in the products?C6H12O6 S _________ C2H6O + _________ CO2(A) 2; 1(B) 3; 1(C) 1; 3(D) 2; 2B. A chlorine atom (Cl) becomes a negatively charged chloride ion (Cl) when it gains an electron and fills the vacancy in its third, outermost shell. Figure It Out: Does a chloride ion have an unpaired electron?
- Balance these chemical equations. (Use the lowest possible whole number coefficients.) (d) NH3 + O2 → NO2 + H2O(e) Fe(OH)2 + O2 + H2O → Fe(OH)3 (f) P2H4 → PH3 + P4Carbon is electroneutral because it has four electrons in it's valence shell true or false ?Nitrogen reacts with powdered aluminum according to the reaction:2 Al(s) + N2( g) → 2 AlN(s)How many liters of N2 gas, measured at 892 torr and 95 °C,are required to completely react with 18.5 g of Al?
- The concentration of alcohol 1CH3CH2OH2 in blood, calledthe “blood alcohol concentration” or BAC, is given in unitsof grams of alcohol per 100 mL of blood. The legal definitionof intoxication, in many states of the United States, is that theBAC is 0.08 or higher. What is the concentration of alcohol,in terms of molarity, in blood if the BAC is 0.08?A food contains organic molecules with the elements C, H, and O in a ratio of 1:2:1. What class of com- pounds do these molecules represent, and what are their major functions in the body?Chemistry CO(g) + 3H2(g) ⇌ CH4(g) + H2O(g) Happens @ 300degrees Celsius The equilibrium concentrations of CO, H2, CH4 and H2O are 12.6 Pa, 7.6 Pa 6.06 Pa and 15.5 Pa respectively. The Kp value is 0.017. a) Determine the value of Kc at 300 °C (Gas constant = 8.315 Pa m3 K-1 mol-1) and calculate the Kp value @ 800 degrees Celsius if the equilibrium concentration of CH4 @ 800 degrees Celsius is 4.6 Pa b) What is the forward reaction exothermic or endothermic? Give a reason