1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA. 2. What does it mean when we say that the genetic code is (a) degenerate and (b) nonoverlapping? 3. How many different sequences of mRNA could encode a peptide with the sequence proline-glycine- methionine-serine? Be sure to show your work. F2 4. A tRNA has the anticodon sequence 3'-CAG-5'. What amino acid does it carry? Illustrate how the anticodon of the tRNA interacts with its cognate codon on mRNA (you do not need to draw out the bases and their exact hydrogen bonding patterns; instead, you can just use the single letter abbreviations for the bases). Where is the anticodon located in the tRNA molecule? Where is the amino acid attached to the tRNA? Your illustration can include the overall general structure of a tRNA to address these questions. 5. What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the "second genetic code." Why has the unction of this enzyme been described this way? 6. For each of the following initiation factors (refer to the powerpoint slides), how would eukaryotic initiation of translation be affected if it were missing? #0 3 E D (a) elF2 (b) elF4 (c) elF5 7. Explain the functional roles of the A, P and E sites of a ribosome during translation. 8. Describe the mechanism of action for the following antibiotics on translation (a) Chloramphenicol (b) Erythromycin (c) Puromycin (d) Tetracycline (e) Streptomycin $ 4 R F F4 DII % 5 T G FS * A 6 F6 Y H * F7 & 7 U J PrtScn FB *00 8 I Home F9 K ( 9 I End O F10 L ) 0 PgUp P F11 T PgDn { F12 [ + = } Ins 1 953 PM 10/12/2022 Del Backspace T
1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA. 2. What does it mean when we say that the genetic code is (a) degenerate and (b) nonoverlapping? 3. How many different sequences of mRNA could encode a peptide with the sequence proline-glycine- methionine-serine? Be sure to show your work. F2 4. A tRNA has the anticodon sequence 3'-CAG-5'. What amino acid does it carry? Illustrate how the anticodon of the tRNA interacts with its cognate codon on mRNA (you do not need to draw out the bases and their exact hydrogen bonding patterns; instead, you can just use the single letter abbreviations for the bases). Where is the anticodon located in the tRNA molecule? Where is the amino acid attached to the tRNA? Your illustration can include the overall general structure of a tRNA to address these questions. 5. What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the "second genetic code." Why has the unction of this enzyme been described this way? 6. For each of the following initiation factors (refer to the powerpoint slides), how would eukaryotic initiation of translation be affected if it were missing? #0 3 E D (a) elF2 (b) elF4 (c) elF5 7. Explain the functional roles of the A, P and E sites of a ribosome during translation. 8. Describe the mechanism of action for the following antibiotics on translation (a) Chloramphenicol (b) Erythromycin (c) Puromycin (d) Tetracycline (e) Streptomycin $ 4 R F F4 DII % 5 T G FS * A 6 F6 Y H * F7 & 7 U J PrtScn FB *00 8 I Home F9 K ( 9 I End O F10 L ) 0 PgUp P F11 T PgDn { F12 [ + = } Ins 1 953 PM 10/12/2022 Del Backspace T
Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Chapter15: From Dna To Protein
Section: Chapter Questions
Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...
Related questions
Question
Question 5
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 2 steps with 1 images
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax