(Multiple coenzymes on the left may match to the same reaction on the right. Some reactions on the right may have no corresponding coenzyme.) Biotin Thiamine pyrophosphate Flavin adenine dinucleotide Tetrahydrofolic Acyl transfer Clear All Oxidation-reduction Transamination One-carbon unit transfer Carboxylation Aldehyde transfer Previous Next
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is one is the steps of metabolism in which complex compounds are hydrolysed into simpler…
Q: Why is a protein's structure important? What can happen if there are any changes? Provide an example…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: Create your OWN diagram to show the lock-and-key theory of enzyme activity.
A: There are two theories describing enzyme activity. They are: 1) Lock and Key Theory and 2) Induced…
Q: You start with 100 units of protein activity and 100 grams of total protein. After the first…
A: Protein purification is performed to purify a target protein from a mixture of proteins. Fold…
Q: Please help with 2a) 2a) There are two different DNA polymerase enzymes, DNA Polymerase I and DNA…
A: Replication is the process of duplication of two strands of a double stranded DNA. In bacteria, the…
Q: a) What is the Kd you measure for this interaction?
A: INTRODUCTION : Actin - Actin is a family of globular multi-functional proteins which form…
Q: What is the role of ribose in Central Dogma of Molecular Biology?
A: The information stored in the DNA flows to RNA and is then used in the synthesis of proteins. This…
Q: See the oligopeptide below. Compare the quantities of high energy molecules (e.g. ATP/ADP/AMP,…
A: Oligopeptides: It contains from two to twenty amino acids and may be made up of dipeptides,…
Q: Insulin deficiency (occurrence/factors) factors affecting insulin levels including biological,…
A: The hormone insulin is in charge of permitting blood glucose to enter cells, giving them the energy…
Q: where in the cell Electron transport chain and oxidative phosphorylation occur?
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Why carbon C-2 and C-5 are mark? why not just ona carbon is marked since just one carbon was marked…
A: Gluconeogenesis is the synthesis of glucose molecules from non-carbohydrate sources such as…
Q: Relate the molecular properties to physicochemical properties of the following Linoleic acid…
A: Lipids are one of the 4 major biomacromolecules. Lipids are insoluble in water and soluble in…
Q: What is an example of RNA editing? Changing a valine codon to a stop codon Methylation of cytosine…
A: Nucleic acids like DNA and RNA can be edited in various ways. Editing is done for various reasons…
Q: In ATP synthase, the ____ subunit is the site of ATP synthesis while the ____ subunit forms the…
A: Oxidation of glucose in the glycolysis and TCA cycle generates electrons carriers NADH and FADH2, As…
Q: What is epistasis, and what is pleiotropy? Describe with examples.
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: QUESTION 5 Oxaloacetate Acetyl-CoA AG" = -7.7 kcal/mol COA Citrate Fatty acids AG"=-1.5 kcal/mol…
A: Free energy change (∆G) of a reaction helps to find the spontaneity of a reaction. Negative ∆G of a…
Q: Which sequencing project(s) would be done better using a next generation method (like Illumina)…
A: Sanger sequencing method - it is also known as chain termination method of gene sequencing. This…
Q: Identify the type of chemical reaction. 1 R R 2 Fat / Oil C01695 -R 3 NaOH/H₂O heat Lye Linoleic…
A: Triglycerides are fatty acid esters of glycerols. Fatty acids are carboxylic acids with a long…
Q: 13. Linear regression analysis was performed for the calibration standard data set based on this…
A: Concentration of any unknown sample can be found out from a standard curve. The standard curve is…
Q: cascade? 1. Platelets expose anionic phospholipids and release thromboxanes. 2. Fibrin cross-links…
A: The process of blood clotting result in mesh formation over any wound and thus leads to blood…
Q: For each of the structures listed below identify the class of lipids to which it belongs (fatty acid…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: QUESTIONS: 1. Aside from carbohydrates, lipids and proteins, what other organic compounds are found…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: A 100 mL of 0.1 M amino acid at pH 1.0, whose pKa for the carboxyl group is less than the pKa of the…
A: The amino acids carry different ionizable groups. The ionic form of the amino acids depends upon the…
Q: In the degradation of glycogen, the purpose of the debranching enzyme is to remove the last four…
A: Glycogenolysis is the breakdown of glycogen into glucose by a set of enzymes. The key enzymes of the…
Q: 8- A B ATP C D А E
A: The cell membrane is composed of a lipid bilayer that allows small and nonpolar molecules to pass…
Q: A patient weighing 38.4 pounds presents with a bacterial infection and is prescribed a course of…
A: A multitude of bacterial infections can be treated with the antibiotic amoxicillin. These include…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: write the mechanism for the reaction of CO2 and the amino terminal of the alpha-1 chain of…
A: Hemoglobin is a multimeric protein that transports oxygen and CO2 in the body. A hemoglobin molecule…
Q: 6. Study the cycle below and answer the following 6.1 Provide a definition for the citric acid cycle…
A: - The Krebs cycle, also known as the TCA cycle (tricarboxylic acid cycle) or the Citric acid cycle,…
Q: What would be the standard free energy change if FADH 2 is used to reduce O 2 to water? Standard…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Lactate dehydrogenase isoforms contain "H" and "M" subunits. In total, how many subunits are found…
A: - A dehydrogenase is an enzyme that transfers a hydride from one molecule to another. - Enzyme…
Q: The following are importance of carbohydrates EXCEPT: O carbohydrates are non-polar molecules O…
A: Carbohydrates are polyhydroxy aldehydes or ketones. Depending on their size, they can be…
Q: Calculate for the initial pH, final pH, and buffer capacity if 0.1 mole of H+ is added to 1L of…
A: The reaction that would take place when we add H+ (here H+ is the acid added) into the given buffer…
Q: Chemistry When the steady-state concentration of a drug on one side of the membrane is 5 micromolar…
A: According to Fick's first law, dC/dt= K(C1-C2)/h
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: NH₂ Methyltransferases NH₂ OH OH S-Adenosylmethionine (SAM) Transamination B Phosphate transfer…
A: Methyl metabolism is well conserved across bacteria to humans. S-Adenosyl methionine (SAM) is…
Q: How is aquaporin synthesised? List step by step. How is this protein made and targeted to its final…
A: Aquaporins (AQP) are protein channels that function in the transfer of water at very high rates…
Q: 1. The peptide below was isolated from fermented milk and shown to have antioxidant properties…
A: Peptide is polymer of amino acids linked by peptide/amide (covalent) bond with release of a water…
Q: Calculate the resulting equilibrium concentrations of all four species. Express your answers to four…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium, the concentration of reactants and…
Q: HN 2 H₂N-C C 6 3 N C 5 C following nitrogenous bases is represented by this structure? 7 ZI 8 CH
A: The nucleic acids are constituted of nucleotides. The nucleotides consist of a base (adenine,…
Q: Compare the principle behind DNA migration in an agarose gel electrophoresis from that of protein…
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: Η Η Η Η Η ΤΙΤΙΤ H-C-C-C-CC-G | | | | | Η Η Η Η Η I ОН
A: A functional groups are is a group of atoms that bonds within a molecule and is responsible for the…
Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment
A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…
Q: 6-25 For Umax 57(Kr+S) constant an enzyme that displays Michaelis-Menten kinetics, what is the…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: You've got a solution containing 60 μM VIP (very important protein). VIP binds to its ligand L with…
A: Ligand-protein interactions are best described by their Dissociation Constants (KD). Let us…
Q: fructose-6-phosphate + ATP fructose-1,6- biphosphate + ADP AG = 30.5 and 16.3 respectively Standard…
A: The Gibbs free energy (G): It is the thermodynamic function that best captures the energetics of…
Q: The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Nonessential amino acids can be synthesized in the body in which the cells provide the carbon…
Q: Based on the structure of sucrose below, is it classified as a reducing sugar? 6CH OH ОН ОН 3…
A: Chemically, carbohydrates are polyhydroxy aldehydes/ketones. They have the general formula :…
Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…
A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…
Q: All are single-electron carriers EXCEPT: a. UQH2. b. Cyt bL. c. Cyt bH. d. Rieske protein…
A: The process electron transport chain requires four different complexes that are situated in the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Using the ActiveModel for enoyl-CoA dehydratase, give an example of a case in which conserved residues in slightly different positions can change the catalytic rate of reaction.The use of co-factors in catalysis : 3.1 Metal-activated enzymes and metalloenzymes definition for each term 3.2 Cofactors Cofactor Origin Structure Catalytic role Nicotinamide nucleotides Flavin nucleotides Adenosine phosphates Coenzyme A Biotin Coenzyme B12 Summaries the characteristics of co-factors using this table. Use both the textbook and other online sources such as Wikipedia to find the information. Under origin, report the precursor molecule e.g. “niacin” and also try to find the Vitamin X name for each compound, e.g. “Vitamin B3”. Under structure, identify the unique structural properties that allow each cofactor to perform the function it does Under catalytic role, indicate for which reactions are each of the cofactors importantGiven each set of information which may include common name(s) and the reaction catalyzed, you are required to identify the main class of the specific enzyme described. _____________________1. Name: alkaline phosphataseReaction: a phosphate monoester + H2O = an alcohol + phosphate_____________________2. Reaction: L-threonine = D-threonine.Other information: Inverts both chiral centers, a racemase. _____________________3. Name: glycine-N-acylaseReaction: acyl-COA + glycine = CoA + N-acylglycine_____________________ 4. Name: lysine decarboxylaseReaction: L-lysine = cadaverine + CO2 _____________________5. Name: methanol dehydrogenaseReaction: methanol + NAD+ = formaldehyde + NADH + H+ _____________________6. Name: citryl-CoA synthetaseReaction: ATP + citrate + CoA = ADP + phosphate + (3S)-citryl-CoA_____________________7. Name: D-xylulose reductaseReaction: xylitol + NAD+ = D-xylulose + NADH + H+ _____________________8. Name: cellobiose phosphorylaseReaction: cellobiose phosphate =…
- A glycolytic intermediate may be used to make the glycerol 3-phosphate necessary for the production of glycerophospholipids. For this conversion, provide a reaction sequence.the following peptide is incubated as chymotrypsin: Gly-Val-Phe-Lys-Ala. Present the detailed chemical mechanism by which chymotrypsin hydrolyzes this peptide. Briefly explain each step. Include only the structure of the final products of the reaction.The chemical structure of Coenzyme A contains the following EXCEPT— a β-mercaptoethylamine residue. a phosphoanhydride moiety. an adenosine-3’- phosphate. a pantothenic acid residue. a lipoic acid residue.
- A simple enzymatic reaction proceeds as follows. E+S↔E.S→ E+P Derive the Michaelis–Menten equation for this reaction.This is a conjectural question: If the reactive part of coenzyme A is the thioester, why is the molecule socomplicated?The purinosome contains enzymes that convert the serine hydroxymethylgroup to the formyl group of 10-formyltetrahydrofolate. Write a balancedequation for each reaction in this conversion.
- Draw the enediolate intermediate of the ribulose-5-phosphate isomerasereaction (Ru5P → R5P).The following are coenzymes or cofactors involved in enzymatic reactions. Identify the biochemical role that each plays within a biochemical transformation: Cofactor/Coenzyme Biochemical Role Thiamine pyrophosphate Coenzyme A Adenosine triphosphate Heme Lipoamide TetrahydromethanopterinWhen glucose is reduced, only one alditol is produced. When fructose undergoes the same reaction, however, two diasteriometric sugars are produced. Draw their structures.